Description :
From Genome Similarity Track
Location :
contig_30:151443- 157757
Transcript NameFunction/comments
g6541.t1hypothetical protein
g6542.t1ETL32185.1 hypothetical protein L916_15179 [Phytophthora parasitica
g6543.t1hypothetical protein

Sequence
6314 bases(100 bases per row)
GGCCGATGGCTGCCGTGTATTTGGGCGAGATGGACAAATCTGCGCCTAGGATCTCCCACACGCAGCTAGCTTCGAACCAAACGTCAGGCTTGATTCCTTC
GTTGACAGCATAATCGCTTGGCGCCTTGTCGACCACTTTCTCCTTGAGCTGCTCGTAGAACTGCTTGAGCACTTCATCCGACAAACCGGTGCCCAACTTT
GTAATGGGTTGGTACATCTCGGTGTCCGGGTCGTAACATGCAAGCAAATACGCGCCGTAGACACCAGTACGTTTACCACGTCCGTAGAACGCACCGATCG
GAACCAGATCAGCGGAATCGCCAATGCCGTCGAGGTAATCCTTCTTTAGCTTCAGCCACTTGTGCGAACGGTTGGCCGGTTCATATGTCGCCTCCCTCTC
CAGGGTCTTCACCATCAATCCTTCACAGTTCTCACGCACAGCCTCCTCCAGGAAATTGCGGACCTTATCAACCGCCTCTTCCATCGCCTCCGCATTATCC
TTCACGTCGACACCATCTTCCACATCTAAGGAAGTAGCAAATTCGAAGTTGCCGGGCTTCACTTCGAACATATCCCGCAGCTTTTCACGGCGTTTTGCCA
GCGGGGTGCCCAGGAATGATTCGCCGTTCAGGAACAGCAAATCGAAAGCGTAGATACAAACAGGGATTTTAATGTCTTCCACTTTCACGTTCTGCGACCA
CAGTGCAAATAAAATCAGAATCCAACACAACCTAGAGATGGTATCGAGAGTTTTGCACCATACCTTTCGAGAGCGCGTGCTCAGAATCTGGAATGGAAGG
CGCTTGTTAGTGACGCGGTCCACCGCAACCACCTCTGCATCAACAATGCAGCTTTGAACAACACCCTTCCTGGAGGCACTTGAGATCGCCAACTTGACAT
CCGGGAAACGCTCCGTGGAGTTCTCAAAATTGCGTGAGAAGATGGCAATTTCGCCATTCGGAAGAATGTGGATCTGCGCACGTTCACCGTCGTATTTGTA
CTCGCAGGTGAACGGCTTGCCCTCAAACCGATCGAACACCATTGCGTACGCCTTGGTTGGTCGCGCGAGCATAGGAGACACGGGTGTTCCTGGCGTGAGC
ACGCACTTCTCAGAAACATTTGCGAAATCCTTCACATGAAGGAAAGGAGCTGTAGATGCCTCCTTCTGAACTTCGTAAAACGCTGCCACCAGAGCGTTGT
AGCTTGGGCACTCGGAGAAGGCTTTCTTGACAAAGGCAAGTGCCTCCTGCTGTTTCTCCTTATCCTTGTAGTCCTTGTCCGTCATGAAGGCGTACGTCAA
TCCCATCAGGATAGATTTTTCGGCCAAGCCAATGCGGAGCTTACCCTGAAGACCACGGATAATGTACTTGGCTCCCTCAGCAGACTGCGCACCGTCGCCT
TGGGCCTTCTTTTCCTTCTCACACTTCACCAGCAAACCCTTGATGATGGAGCATTTTTGCTGTTGCGAGTTGTTCCCGGTCATCTTCGCGATCTTGACGA
ACTGATTGTACACATGCTGGACAGTGAGACCGCTGGCTTTAGCAGTTGCGGGTTTCATAGAGGCAAAGGAAAGCGTTTTCTGCTTCGATCGCGCATTCTG
CGCAACCTTACCGAGATCGCCCTCCTTGTTGTACATTTCCTTGATGAACTTGAGGTTGGCACCTGTCGCCTCGCCAATAGCCTTCATCAGGATAGCGTCA
CCAATGCCGATCTTCAGGTTCTCAAATGGGGGCGCCAAGTCAACGCACACGCAGAGGTAGATACAAGCCAACAGATCATCCGGAGAACGACGAATGACGT
CACGGAAGAATGCAGTGAGCAGGTCTTGGATGACGAGACGGCCTGTGACTTCTTCAATCTTGGCAAACAAGTGCGCCAGAGCGAAATACGGAGTCTCACG
GGGTCCGTCGCTCTCCTCTTCCTGTTTTTCAGCTGCGTTGGCCTCCTCTTTTTTGCTCACCTTGCTCTTCGACTCGGACTCCGTCCCACTCTTTATTTTC
TCTGTCTTCTTACCGTTAGCAGGAGTCGTCTTGGTATTCTTCGCAGCTTGCAAGGAGAAGAAGCCAGCTTTCGTCGAAGTAGGTGACAATGCCTCCTTCT
TCGTGTCGGTCTTTTCAGACGCTTTCTTCTGCTCAACCTCTTCAACTTCCTCTTCTTCAGCCTCCTTCTTCGGCGTCTTCGTCTCCTTCTTGGGACTCTT
GGTCTTCACTGGCGTCACGGGCTTCGTCTCTTTCTTATTGGGACTCTTTTCCTTCTCAGGTGACGTCATGTCAATCACTTCCTTCTTCTTCTCCAAGGCC
ATGGGCAGATCCATGTCGCTGTCTTCATCTTCCTCCTCTACGATCCGTTGCCGGAGACGACGACGACCAGCTGCAACAATAATAAAAACCGAACAGATAA
TCAGCCACGGCCATATACCAGCAGCAAAATAAAGAGATCCACGTACGTTTCGTCTTGGTGGCTTCTTCTTCATCTTTTTCGTGTTCTTCTATGTGTTCTT
CTTCCTGCATTTCGACGTCCTCGGGCTCTTCCTCCATTTGTTTCTCTTCCTCCCCGTCTTGTTCTTGTGCCTTCTTCGCTTCTTCTTGTGTCTTCTTCTC
TTCTTCTTCTTCTTCTTCTTCGTTTTGCTTCTTCCTTTTCTCTTGTGGCTTCTCTTTCTTCGCCTTTTTCACGGGTTTATTGGCGGGTTTCTGCGCCTCG
TCGTCCGCCGGTTTGCGCTTCTTGGGGGACGACGTGGGGGCCCCCGCGCCGAAGAACGACATGATGGAGCGCTGCGTCTTGGGCGCAGCTAGTGTCACGT
GAGCACATTTGTATGTGAGTGAAATGGGTCTCCCCCAAACAGCCCAAAATATACAGCACCTTTCTTCCCCATTGTCACTCCACGTTCGCTTTTCAGCAAT
TGCAGCCAAAACTTTTTGGCGCGCTCCAAAGTGTACCCATCTCAAGCGGTGTCAATAGGCGGATAGTGGAAATACAACAATCCTATTTATTTGGCGGGAA
AGCTTTAAAAAGGGTATCCAATCGTCAGAAATGGGTCGCAAGTTGCTGGCACTCGTGCCGTCGGCGCTACCGGCGTCCGCCAACCTGGAGCGCTTCCACG
CGGATGCGACGGACGCTCCGTTGCTCTCAGTGGTCGTGTGGAGCTCCCACGGCCCTGGGGACGCCACGCGGACGCGTCAACTCGCGCTGGACCGCGATCG
GCACCGACTGCTGGAGCTGCAGCGCGTGCAGCCGCCCGATGGCGCGCGGAGTTGGTTTTTGGGCAACTCGGTGGTGCAAAATGGTTCCCTCACGCTGTTT
TCACCCATGGACGCGCTTTTTGTGCTGCTGGACGCTGCATGGGCCCAGCGCAAAAGGTTCTCGTCGGTGTTTGACCTTTTGGCGCAAAATGGGAACACAT
GGCTGCTGCAGCTCTCGACACTAGACCAAAAAGTGCTGGAGACGATCTGCGACGTGCAGACGGTGGGAGGAGAAGACGGGGTGGACAACCTCTATGTGAA
GGTGAATGCGGGTAAAGTTACAGGGTGGTTAAGGTCCAAAGTGGAGAAGGTGGCTGCAGTGCTGGCCACGCAGGAGAAGACGGCGGCCAAAGGTGACGCG
TTCGCGGAACAGGTAAATGTACCAGGACAAGAGGGAAAGAAAGAGTGTGCGGAGGTGAAAGAGGAAGTCGTCGCTCGCCATTATCGCGAGGCCATTGGCG
TGGTGGGGAACTACCTCCCGGAAGAGTGGATCGAGCTACTGTGCAAAGAGTTCAAGTACGTTGATGAACAGAGTTTTTGTGTTTTTTTGTTTGTTAGCTA
AACGAGTTCTATTTGTTGTTCTTAAGGGTGGAGACGGAGGTGGCGGTGAAGACTCCTGCCAAGTCGGCAACTGGTGCCCAGGACAATTTCAGGCGCTTCG
ACCGACGTCAGACACCCGAGAGTGGGTCCAAGCGCTCGACGCCTGCTACGGCTGCTGCGACCAAAAAGAAAAGCAAATTGGCTAATGTGGATCGCACCGG
AATGAAGTCGCTGACCTCATTCTTCGGCAAGAAGTAGAGAAGTTGCAGTTTTCGTTGCATTTCGCAGATATATAGAGCTGTTTATCATCTACCGTCGCGA
TGTCGAGCCCTCCACGCTCACCCGGTGCACTTGCACGAAATCGCCCCAGCCAGAGAGGATCCTGAACTTGATAAAGGAGGCATCCGTTGGCTTGACATTT
TCGCTTACAATTTGCATCTCTCCGTCGGTCTCCTTGAGCTCTGGTAATGGCAACCAACCATTAGCTGTAGAGCACCAAGACAACCACATGATTTACTCAC
TGGCATCGAAGAGCTTCTCCCATTTGGTCGGGGTTGGTCCACTGCAGGCTTCTACGGACACCTCCTTGACATTCCGCGTCCACATCTTGGCACGAACTAC
AGAAGCCGTCGTTGCAAGCTGAACCACGAGTTCCTGAGGAAAGCTTCCTGTCGTCACCCACTTGGACGATTGCTCTCTGCAACAACCAAGGCAGCAAGGT
TACAAAAGTTTACAAACGCAGAAGCAGGACACACCATACCCGTCCAAGATGTTGACCGGTGGGAAGTTCGGATCATACGAAGTCACCGCCGTCACCTGGG
CGCCCTCTTCATCCAAAGCGAGCTCCATCGCGACCGAGACGACTAACAGACTTTCGGGGAACTCGGCTCTTGTGATTGTGGTCTGCCTTCTGTCCTAAAA
ACCGCACAGCTTAAACTTAGAACGACGCCACAAGAACAAACATAAGAATAGCTTGGGACGCACTCATACTTATCATCTCCATTTGCACAACGCGGAATGC
ACAGGCGACTTTTACTTGAACACCCTCCTAGATACCGACGTCGCAGGCCACAGCGGGTGGCTTTTTCACGGTTGCTCTGATGCTCCGTGAGCTTTTCGTC
TGCAGTCGCGGGCTCTAAATCATGTTGGAGGCTGCCCAAAACCCAATTCACTGGACAACCGCCGACCTACTTACGTTGTCAGCGGTGGCTCAATTGACTC
CTTGTACAGCCTCTCGAAACCCGCCGACAAAATGTCGGCTGCACGTGTGATACCCGATCCATCGTCATTAAAGAGCTTGCAGTTCGACCACATAAGGCGA
ATGTCGTTGGCAAAGTGCGTAGAATCAAGCTCCTTGACACCAGCCGCCACTGTGTTGCTGTCCACAATGTACGCTCCCTTCTTCAGCTTATCCTCGATTG
TCGACAAGTCCATTGGCTGCTTCACCACCCGAGTGTACATCGGAATGTTCTCCACGGGCGTGAGGAATGGCTTTGAAAATGGATGCGACTTCAGACACGT
GACAATTTTCAGGCACTTGTCCAGCAAGCCTTGCTCTGAAGCCACAGCTGTGGAATACAAATCGAAACGAGACGGCTTCCGACACTCGGCGCATTGCCAA
TCCCCCTCCGGTAAGTCACTCTCCTTCATGTGCAGACACTTTAAGTGGAAGGAGCGCGGGCACTTGTCGCAGCACACCAGATCACCAGCACCCTGACAGA
CCTCACAGAAATCCAAGTTCGTGTCCAGCTCGCTATCTGAATCATCGCCCTCGTCTTCATCATCTTCGTCGTCTTCTTCGTCCGCTTGGTTGTACGTTTC
ATCCTCTGTTTCTTCTTCGTCTCGTTTCACTCGCTTGGCATTCTTAGGAGGTCTACCTCTTCCCCGCTTTGGGGGCGGAGTAGATTTACGCTCTTGTAGA
TTCTTCCTCTCTGCACGAGGACCAACTGAAACACTGCTCGGTGTATCGTTTTTTAGCTGGCGCGGGCGACCTGGTCCATACGCTGGTGATGACTCCGCTG
AACGACTTTCCTTCGGATGACGTTGACGAGCAGGGCCGTACGCCGGTGACGATTCCGCTGAACGGCTTCCCTTAGATCCCGCCTCGGCTGTGTTTGCCTT
CACACTACCATCTAGCTGGGATGCAAGTTTTGATCTTGCATCAGGCGGATATCGGTTTTTCTCCTCATCGTTGTGTTCACTAATAGAGCTTTCATCGCGG
CGCGCTAACCTTGAATCGTTGCGTATATCGTTTGAATTACGTGGCGCTGGACTGTCCTCCGCATCGCTTTCGCTTGCTTTCCGCTTCCGTGCGTGGACTT
CTTCTGCTGACCGTGCACCTGCACTGGAGCGATCACGAGAAGTACTTTCGTCTGCCGAGTCCATCGAGCTGGTCGATGATTGATCTTGATATGGGCTATC
TGCTTGGCGGCGTCTGTTGGCAATACCTCGTTCAGCAGTCAACCGAGAGGAAGCTTCCATTTCATCGCCAGAACCTTGATCACCAGAATCTTGCGCATAT
CCACTGCTCTCCTT