Description :
From Genome Similarity Track
Location :
Scaffold_57:15144- 16645
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G014039Similar to AHI1: Jouberin (Homo sapiens)

Sequence
1501 bases(100 bases per row)
GGTGCCACATCGCGTATTGTGTCGTCTCCCAACGGGCAAAAAAGGGTGCTCGTGCGTCGCATTCAGCCCTTGTGGCTTGTACTTGGCTGCGGCGATCAAT
CCTGGCTCGGGCGAGTTCCTTATCCACATTTACGCTGTCAATTTGAGCCACTTGGTGCAAATTAGTCGTGGGCATTGTGGCATGGTCTACGCGCTGGAAT
GGGGTACGAACAGTCAACGCCTGATTTCGTCGTCGTCGGATGGCACAACTCGCCTTTGGGAGCTTCACGCTACACGAAGAGGTTCCAAAAGTGGCATCAA
CTGCACGAGCAGCGCTCTGTGGCAGCACTCGCCCTCGCCGTGCTTTGTGTACTGTGGGATTTTCCATCCAAGCCGCGAGGACCTCGTTCTCACTGGTGCC
TCTGATGGTCAGCTTCGGGTCTGGAGCACACTCGCCTCGAAAAGCAACGTGGCGATCCATGTAGTTCAAGTCAGCTTTGCTGCTCTCCACAGTATTCGCA
TTGAGCCAAAGTCGCTTCGACTGTTTTGTGGCGATGCTCAAGGAAATATCACGATTTGGAAGCACTTGGCAACCTCGGCGAGCCCCAATCCACTGTCCTA
TGAGCTGATCAAGACCATTCATACCGGCCAGAGCGCGGTCACGAGCTTGCAGCTTCATCCGAGGAAACAGCATCTACTCGTTCACACGCAGCCCAACTTG
CTGCTGAAGTACGAATTGCGGTCCTACCTGCTTCTCAACAACAGCTACAGCGGCGTCGTCTGCGAAACACTGATGGGCAAGAGCAGATTCAGTCCCGACG
GACGATTCGTCGCGAGCGGCTCGGAGAATGGCGTCCCGCTGTTGTTTTCCAGCATCCACGGTGGCCAGAAATTCCAGCGCGGCGTCTGGGGCTCGCCGTT
CTTCCACCAGCATCCTGTCATGGATATCGCGTGGTGCCCCTCGGCGCATATCGTTGCATTATGCTCCTATGGTACGTCTTTTTATCAGCTCACCAAGTTG
ATACTACCGTCTTCTGACATAGAACTTTGAGGTCTTTGTTTGTAGGTGGAAACCATCCGATTGTGCTGCTGTGTGCGTATCGAACCGACGACGACGTGGC
GCAGCATTTGCTGCTGTCTGCATCGTATAAACCTTCAATGACAAACCCGTTACCGACAAACCTCGCGGCAACTTTGAGTGATGCAAGGAGAGAAGTTGGT
GCCAATGCGTCAATTCCTGCCGCTTCGTCCTCCGATGAGCAAACTGCTGCGCGCGTTCAGCGTGCGCTGGAGAGACGGCGGCAACGTCTTTTGGCAAAGG
TGAAGTCGTAATATTTCTTGTGTTGTGCTGTGTTGATTTGCTGATCATGGGGTCTAACGAATTGAATCTTCGTTTGTTTTAACACATATAGGTTGCCCTT
GAGACGAAATCCGTGGAGACTGTGGCCCATGCTTCAATCTGATAGCATTCGTGCCCTTAAATGCGCATGGAAGCCTCGACCTTCATGCCAATTTTGACTT
G