Description :
From Genome Similarity Track
Location :
Scaffold_26:15141- 20713
Transcript NameFunction/comments
Phyag_g723hypothetical protein PHYSODRAFT_507179
Phyag_g724hypothetical protein PHYSODRAFT_354853
Phyag_g725eyes absent family protein

Sequence
5572 bases(100 bases per row)
AAGCAGGTGTGGGCCACATGAATCTTGTGTGGAGGTGGTGTGGCACACTGTTTGAATCAAGCACCTTGAAGCGAAAGAACAATGGAGGCACACGTCGACA
TCAAGGAGAAGCTACTGCCCAAGATTGAGCCGATCGTACctcagcgccagcgccagcgagtGGGCGGGAAGGCCCCCACGGCCTCTAAGCCcggaggcgg
tggcggcagcaactccagcagcagcaacaacaacaacaaccctCCAACCCACCCCGTCGGATTCGGGCGCACAGGTCAACTGCGCCTAGCGGCGTGGCTG
gtcgccatctcctccttcatgtGGGGATTTACTATGGCCGTGCTCAACGTCTGCATCGTTCCGGATGCTGTGGGCTCTCTGCTTGTGGATATCAACCTTA
CTAcagaggagcaggagcggGCTACAGCTCTCGTGGTGGTTGGTTGCATCCTCACGGCGCTTACGACGGGAAGTGTGGGGGCACGCGTGGGTCAGAAGAA
GACCATCCTATGGAACAATGTGCTGTACATTACCGGCAGCGCTTTATGCGCGCTGGCAACGTCAAAGCGCGTGCTCTACGCTGGCCGACTGGTCATTGGG
TTGGCGTCAGGGGTTGTCACCAACACAGTGCCCATCCTGTTGACGGAGATCTCGCCCGCTCCTTCGCGCGGCGAGATCACGTCACTTCATCAACTCAGTT
TGACGATTGGCATGTTGATCTCAGCTGTGCtgggcttcttcatcatcttgaaCGTGCCGTCGGGGTGGAGATATCTCAATGGGTTCATGatcttgccgcc
gctgctgcagtgtttgACTGCGTCGTTCGTGCCGGAAAGTCCGTGgtggttgatgaagaaccGAGGACAAGATGAGTGTCGTGCGATGCTGGTGTACCTG
CGTTCGAGAAAGCAGAAGGATGCGATTGAAACAGAAGTGCAGGAAATTGCTCGTGTCATGGAGCACCGCCAGCACGAACCTCACGTGACATGGTCGCATC
TATTGGCACACAAGAAAGTTATGGTAACAGGGACTGTTCTCGTGTTTTTCCAAGCAATGACCGGTATCAACACGGTAATGTTGTACTCGGCCAAGATTTT
CCACTTTGCAGGAGTGACCAACCCGTTCTTCGCGACAGCAGTCGTAGGATTTACGAACGTGGGCGTCACTATTATATCTGTGCGCTTTGTCGACTCGTAC
GGCCGGcgaccgctgctgctcatgggcaCGGCCATTATGATCATCGCTCTAGGTGTGCTCAGCTGGTCGCTACTCTACCTCAACAACAACCTTGAGGTAC
AGGGTATGGTTGCTGTGATTTCAGTGCTCGCGTTTGTTGGCGGGTTCGCGGTGGGTCTTGGTGCTGTCGTGTGGTACGTGTTTACGTGTTGCTAGGTGTC
GATAGGCGCTGTGCTTATTCCCGTCATTTTGTATATTGCTGCACAGGGTCATGCTAGGAGATATTACGCCGGTACATATCCGCTCTCGAGCGTTTGCGTT
CTACATGGGTGTCAGCTACATCTGCAACATTTTGATAGCTGTGTACACGCTATCTGCTATCAACTTTCTGGGCCGCGGCTCCAATCCTGAAAAGAACGGC
ATCGCCAAGCTGTATTTTATCCTCAGGTATGAATGCCAACGCTAGTACTTGTTGGTTGGTAATGGGTGATCACTAACACGAGTGTTGTGTGCATTGAAGT
ATTGTTGCCGCGACATGTCTTGCATACATGTACGGCTTCGTTGAAGAGACCTCCCACATCAAAACGGCACCTGCAACACTTGCTGATGATCAGAAGTCGC
TTTTAGCTGAGGAAGGCATAGAGGAGATGGATGGAGAGTTCGGAATTCTACGTCAAACGACCGATCTATAACTGCATGATAAGCTTCGCATACACAGCTA
CGCGGAAGGACCCAAACAAAAGTCAATCAAGCGTGGCAATTACTTCGAAGTATCAACCTGCTCGgattgctgtcgttgtctACTATCTATTCTGTGCTAC
CTTTTTTTTCCACGATGCTCCATGTCAGTGTCTACTGCTTCAGCAGTTGTGCGGCTTCGGCAATTTCCCGCACAGCTTTGGCGACGGAGATAAGGCGTTC
ACTGTGGTCGTTTGGAGACAGCGAGTCGGTCAGCGCTCCCATTTTCTGCAGgtacagcaagaagcgaaaaTGTCAGTATGTCAACAGTGTTCCTAGAGGA
AAGTGATCTGCCGTGATGAGTTTGGTTTGTCTGCAAAGATCGAACTGGTAGGTCCATGTGATCGTGCCTCAAAACTCTGAATAAGCCCAAGCCTCAGATT
AGAAGAAATGCGGATGCTCCACCTGATAAAGCGCGGCAAGAGTCTGGCGGCGAATAGCGTTCACTTCGGCGTCACTCTCAGCGCTGCTGGGGTTCACCGC
GTTGTCAATCTTGCGCTTCGCTGGAGCCAGTAAAATAAACAACGTCTAACGTTAGCTATCTCCAACCAGACCAAAAAGTCTAAtactgcaacagcagcgt
aCCAGCTCCGTTTGCGGTGGTCGTTGCTCGCTGGATTTtcgcctgctccagctcctgcaactCTCTCGCCTGCTTGGCTTGCTCCTCCAAtcggaactgc
tgctcgataTGACGCCTGCGTTCTTGCACATACCGAGCTtcagcctccgcctcctctttctccgctgcagcaagttcctCGGCCTCTTTCTcagcctcct
gcttcttggcttcctcctccgtgacCACGTACTGGTCGCACCTCACACAGAACATCTACCAAACGCAACATAATCCCTTTTAGCTCAGCTAGAGCAACGT
TCAAAATGCTCTCAGTCCGCCGCTCACCTTTCCCTGCTTGTTGCGCATCAGCGGCGTGTAGCAGTCTTCAACGGGGCAGCTCGCGCCCAGCATCGTCCAG
CCCTGCAGCATTttctcgcccagcagcttgctgGCTTCATCGCGCGAGCGCTTCACTGGTGCAGTCGGATCCATTGCTTTCTCAAATTATAATAATTTTG
GCGGGAATAGTTTTCCCGCTAAAAAAGTAAATAGAGGATAACCATGGCAGAAGATGCTTCGACCGTCCGTGTGTGTCTTACGCGCTGCCCGTTGCCGCCG
ACCGAAGAGCGCGTGCACTCGCTGCCATGCCGTATCCACTTTGACGGGCCTGCACCTGTGAAGACCTTGTTCCGGCCGCAGCGTGGCGATTGTTTGGAGG
TGGAAGGCGTcaaaaaggagaagaagagtgaCGGCGAAGCGATGCAAGCGGAGTTCCGCGGCATTCAACTGCAGGGCCAGAAACTTGAGTTGCAGGCTAT
GGGCTACACTGGTGCGTGTTGCTACGTGGGACCAATTGAGGCGTGTTAAACTGCGAAAGTCACTTTGACACTAATGTTGTGACTGTACTTGCAGGCCTCG
TGCTAGAGGATAGCGGGTTGCGACacacggacgacgaaggcCGCATCTGGGAGGTGGAAGACCATTTCAAAGAGCTCACGTGGTGGTAGGGCTGCATTAC
CTAGGTTTGGCTTCCAGAGGGGTCTCCGCTAACTTAtagtgctgttgctgtatATATAGGGACGTGACAAACCACACGACAAGCGAGacacagcagcttc
ccttgatgctgcagcaatggagcGATGTCTCCTCTGCGGTACGTACAGCCAGTCGTTTGTGTTGATGGCACCTTCAACGAGCGGGCTAAAGTGCCGAATC
CGACCTCGAAGCGGTAGCCACCACTCATCCTCGCGTTTGTTGTTGCGTGCGTTGTAGATTCACGGGGAATGAATTGAAGACATTGACTTGCAGTTAGTCT
GACTCCGCCTTAGTCCCTGGCAGCTAAAGTCTAATGCACGTCGTTGTTAGGCAGCcttgcttcagcttcagccatTGACCAGCAAACCCTGCAAATGTCC
CCAACTGTACAATCCTTGTTTCCGATTCTGTGGCGCAATCGGCTACCGTCACCGGAACAAAAGACAGTCCATGTTTGTGACGCTTGCTCTGTCGAGAATC
GAATTCATTCCACTCCAGCCCAGCCCGGCTTCGGTGGCGATGGCCTCCCGCTCGCCTCACTCGCGTACGCTCGTGACAAGGAACAAGGCGCTACAAATCA
TGCGAGCGCAACTTAAGGACGCCGTGGCCaagctggtgttgctgccggTAGTGGGCGTGAGTCTGTGCGGGGCCGTGACGCTCCTGTTAGGACTGCAGTG
GGTGGAGGCCCTACAGCGCAGACGCCAGGCGCTCCAATGGCGCACGCGACTGTGGGCCACACTACTGACGCTCctgctgacgttgctgccGTCCAAGCGA
CTCGAAGCGGCCGTGACACCAGCGGAGAAGGGGCCCAGTCGACTGAAGAAAGAGGTTCAACTGTATAGTGGAGACAAGAGAGATGCTCATGACGGAGACG
CAGTTgggggcgacgacgagagttATACGTCACGTCCTGCGAAAAGGCAACGGTCCGAGCCTAATGAGGGAGAGAGAGTGGAGAATGTAGGACAGGATGA
CAGGCAGgatgaagaaaaacaaaCAGGTGAcgagacgacgtcgacaaaGGTGGTGAAGCCTGGAAGCTCTGTAACGCCGCGTATCCGGAGGCGCGTGTTC
ATTTGGGACTTGGATGagacgttggtgttgtttgCCTCATTGTATTCGGGAACATTTGCTCAGACGCACGGCAAGGAGGTGGCGCCTGGGGTGGCTTTGG
GAGAACAGATGATGACTTTCttgctggcgatgctggagagacacttcttcttcagcgacttgCATGATGCAGACGTGGACCATATTGCTCACGTAGTTGA
GACGGAGAATGCAACGGATCAGCAACAAAAACCTACTGTTCAAGAGAGATACGAGCGGATCCGGGAGATCTACGAACGTCGTGGACATGTGGACTTTCTC
CATGATACGAACAGTGAGTGGTTTGCTATCCGTGGCGCTCTGATTGCAGCTATTGATAATTTCTCAACGGGATGGCTACATGAAGCACGGCAAGTGTTGG
AGCTCATTGCAGAGTCGGCAAAGTCTCGGGTGGAACCTACACAGCCTGAAGCTCATCCCGAGACTGAAAGTATCGACGCGAGCaaagatgaggaagaggt
ggagaATGTGAACGTGATGGTCACAAACACGCAACTGGTGCCGGCACTGTGCAAGTGCCTTATTTACCAACTCGACGCGTTCTTTCCGATCGATCGCGTG
TACTCCTCGGCGAAGGTGCACAAGTATCGATGCTTTCAAACAATCATGGAGAAGTATGAAGCACCGGATGTGGAATTTGTCGCTATTGGTGATGGgcttg
aggaagagcaggTAAGTCTCGCGCTCGGTCTCGAGTTCCACAAGATTCGGTCACTTGTGGATCTCAAGCGACTGCGTTACGACCTGCAGCTAGTCCaggc
caacagcaacagttCGACGCCGGCTTCTGCAGTGGTGGACTCAccagttgttgctgcggcaCAAATGTCTGTGGCCTCCTCCCCCGTTGGCCAGACTGCT
GTAGTCTAGGCGTTGAACGTCACCTTTACTTTCATCTGCGCAGTGAAATAACAAGCCTTATTTATTCATCGA