Description :
From Genome Similarity Track
Location :
contig_69:15138- 16672
Transcript NameFunction/comments
g12161.t1hypothetical protein

Sequence
1534 bases(100 bases per row)
CTTCCTCTGTGCAAGCTGCTGTGTGCCCCGTCACACTTGGTAGCACTTGTAGTCAATCCACGCCTACGCGGGTAGGATTGAACTACCTGAATCCTCTGTG
ATCTCAAAGCCTGAGCCACTATGGAACGAAGTGAGTTTCCTCACTTGAACGACTCGCAGTTCCAGTCCGTTCGAAAGATGGGAGGCATCTTTGGGAGGGA
TGTCCTCCGAGGCTTGGCGTCCTTGACGGCAGCCGAGCAAGTCGAACGCGTTCGACACGTATGAGCGTGAGCTCATTGCTCACGTGCAGAGAAACCTGGA
GGCCTCTGTGGCCGAGCCGAAGCCTGTCCAGCCGAAGCCTTTGCGGCTGGCTGTGCCTGCGTTCGAAGGAAAGGAAGGTGAAAACCTTCACTTCTGGATC
CGAGAAGTTGAGATCGCCATGAGGGCGGGTCTCATCTCGGATCAGGGACTTCGCATTGCGTTCGCGTTGTCCAACCTAAGCGGTCGTGCCAAGAATTGGG
CGTACACGCTGGAGACGACGTCTCCTGAATGCTTGGCATCCTGGGAACAGTTGTGCGAGCGGCTTCGCGCTGCGTTTCTCCCGGCGAACGATGGGTTTCG
CCAGCGCTCACGCTTCCTCGCCTGTAAGCAAGGGAAGCGCGAGCTGTACGAGTACGTACAAGAGATGCGCACGTTGGCATCATCGTTGGTGGGGAACCCC
CTGCCCGAAGACGTCAAGACGACGGTCTTCATGGACGGCCTGAAGGTCGGTCCCGCACGCACGCAGTTATTCCGCGCGCATGCATCCACTATGAAGGAGG
CGGTTAAGATCGCCCTCCAGGAGGAGTACAGCCATAAACAGGCTGGCACTCCGGTTGTTGCGCAACTTGTCGTTGCGAACAACGAGCTAGAGCCTATGGA
CTTGAGCTCTGTTGAACTTGGCTCGGTCGGCTGCTATAAATGCGGCGGACTAGGACACTACCAACGTGTGTGTCCTTCGACTGGGGTGGGGAAGAACCCA
TCCCTCAAACCCCGAGGGCCTAACGGTCGCTGGCGCAAGCCGCGGCCAGGTAGCCGAGGGAACGCCGGCCACAAGTAATGGCGGGTTCCCCAGAGGGGGG
AGAGTTGAGTCTCCGTGACGGGTGTGCGGGTAGTGCACACCATGGAGGCTTAGCCTACGAGAGACATTATGTCTCGAATCGGTGATGGCAACGCTGGGTT
GCCGTTAGTACACGTGAGTGTACGGGGATGTTAATATCCCTAGGAACGTTTAGTTCCAGGGGCGCCGAATGCTTTCGTACACCGCCGGAGCGATTGCCAA
CTCTCTGTGAGAGAGCATCGGCAATGGTCTGCATAGACCTTGCTGTCAGGTTCACATACCTGAACAGCTGCGACCCGTACGTGGTCGTGGACACGTAGGG
CGTCCGCTTGGGTGCGCCGTGCCATGGACGCACGCACCCTGAAGCAATTGGTGTCGGAAAGCCATCGAGTCTAGCCGGCACCCAGCCTCTGGCAGAGCAT
TGGTGAGTCATGACCCCACCTCTGCCAGAACACA