Description :
From Genome Similarity Track
Location :
contig_1:1513585- 1514974
Transcript NameFunction/comments
g404.t1hypothetical protein

Sequence
1389 bases(100 bases per row)
AGGAGTCGTAGCAGAACCAGTGATATCATTTTGTCTGGAGCGTAGAATCGAGCTCAACCTTTCGAACAATTTCTGCTGGATGATGGGCTTCATCGGCGGG
ATCTTCTTCACAATAGTTGTCAACGTCTCCACAAGTGAGGAGTCCAGGTCGTTCTGAAAAAGTGGCCCCACCATGGATTCCAAGTCTACTCTGATAAGCG
CAGGCCCCACCGTCTCCGCAAGCATCCGCAAGCATGCAAGTGCCTCACGATGTGTATCGAAATCCTTCCTACGGACCTGCAGTCCGCCCTTAATGCCGTT
CATAATCGCCATCAATGCCTGTTCGTCCCTTGCCAGCAATGGTCCAATCGCCAGCGAGAGTTTCCCAATTGAAAGCAGCGCGTCTGGGCGCGTCGTCGTT
GTCGCCGAGAAAAGCACCTCCAGCAAATGGTTCATACACGGTCGATAGCACTTTTCCACAAACACCGATGTGTTAAACTTGGCCAAGCGTGGGAAAGACT
GATGACAGCCGATCGCACAGTGGCGCTCTTGTGGTCCTGGTGGCTGAAGACAAGGCGACAAGCTCGCGCATAGTGCGAGTGCATGAAGTCCCCAGTATTC
CTTAATAACTCGTTCAGAATGAGCAGTGCGCCATGCGTTGCATCGGAGCTGTTGCGCTTGAAAGCCTTCCGCCTCGTCCAGGGCGCGATTGTACCACGAC
GTCTTGCGGTTGGACTCGCGCTGCTGGATGAGCATGAAGCACGACTGCAGCGACTCGCTGGCACTCACTCTCACCACGAGCTTGGAGTCCCAGAAGGCGC
TCCAGATGAAGTCGAAGTACTTGTCCATGTACCTGAAGGACGTCGAGGGCGCGTTGATGGACAGCTCCTTGAGGATGACGACGGCAGCGTGTCTCCTCAC
GTGGAACGTCTCGTTCTTGAGCCACTCGAGCGCCGGTTTGACGTGGTAGTCCTCCACGAACTCAATGAGGCTCGTGCCACCCGTGGACACGATGTGGCCG
AGCGCCTTGGCGGCCACGCGCAGCATGGGCGGCTCGGCGCTCGGGATCTTCTCGAACACTTTGGTGAGCGAGTGCGCGAATTCGATGATGGTCTGGTCGT
TGCGCTCGGCGATGAAGAGCTCCACTAACTCGTCCATGGCGGCGATACCCCCATGCGGTCCGCGTTCTCGTTCGAGTTGCACAGTAGCAGCAGCCGCGCG
CTGATGTCCGTGACCCACTTCATGTAGAGCCCGTGCGACAGGTCACGCGACTCCGACTCGATGTACAGCCGCAAGCTCTGCGCCGCGCGGTGCCGCACGC
TGCTGCTGCTGCTGCGCAGCCCCGGCAGGAAGCGCGTGAAGCTCTCCGTCATGGCCGCTCCCCTTCTGCCGCGGTACGTTCGCAAATGC