Description :
From Genome Similarity Track
Location :
Scaffold_64:151352- 153118
Transcript NameFunction/comments
Phyci_94174arginine biosynthesis bifunctional protein argJ puta

Sequence
1766 bases(100 bases per row)
CGCGTTAGTGGCTCCAGCCAAGCCGTTGACGATAATTCACGCCTAATCTGGTGCAATCTACGACCGGTAGTCCGCGTTAATGGCCACGTACTCGTGCGTA
AGGTCGATACCCAGCACCTGAGTCTCCTCGGAACCAACACCCAAGTCAATCTCCATCTGCCATCAACTCGCAGTTAGAATCATCGCTCAGTAGATACAAT
AAAACAATGAAATGCGCGTACCTCGACAAACTTCCCGTGCGGCGGGTAGTTGTGCGAGCTAGCGTCAAGGCCACCACGGGTGGGCTCGATCAGCATGGCG
TCGCGCATGTGGGCCACAAGCTTGGCCTCAATCTCGTCGTTGAGCACCATCTCGCCGTTCTCGAAGATTTCGACCCCGCCCATGCGGATCGTCATGCGGC
GCTGGATATCCACGTCCTTGTGGTGCAGGCCCATGTACTTGCCAACGGCCATGACAAGACGGCCCACGTTCGGGTCGTTACCGGCCACAGCGCACTTGAG
CAGCGGCGAGTTCACCACCGACTTACCCACACCCTTGGCCATCTCCTTGGTCACGGCGCCACGCACGCGCACGCGCATGACGTGGTGCGCGCCCTCGCCG
TTGCGCACGATGTCCTCGCTCAGGCCCAGACACACCTCGTGCAGCGCCTTCTTAAACTCGTCCAGCTTGTCCATGTCGAAGGGGATCTGGTCCGACGACA
CGAGGGTCACCGTGTCGGACGTGCTCTGGTCCGTGTCCACGCTGAGCGAGTTGTACGTGTCGCCCACCACCTCCGTCAGCAGCTGACGGAGCACGTCACG
CGGAATCGACAGGTCTGCAGCAGCAACCACCACATCCCCGTCAGTAACGCATCAACTCCGATGCACTATGGTCATCCATCCACTCACCCGTGAGGATGTA
GGACAGCATGGTGGCCATGTTGGGCTCAATCATGCCGGCGCCCTTGGCAATGCCGACGATGCGGCCGCCGCACACGTCCATGGAGCGGATCTTCGGGTAC
AGGTCTACCACCAACGGATTCAATTGTCAAAACACAAGAACTCAATGAAAACCAACTGCGGCCGACCGACTCACCCGTGGTCATGATACCCTCGGCAGCC
GGCAGCACCGAGTCGGACTGCAGGTTGGCCACGAGCCTGGGCAGGTTCTCGACCATGGCGTCCACGGGGATGCGCCAGCCGATGACGCCCGTGGAGCAGG
GCAGCACCTGCGCGCCGCCGTCCAGCCGCAGGTGCTTGGCCAGGCCGTCGCAGACCTCCTCCGCGTCGGCCACGCCGCCGCCGCTGGCGCAGACGTTGGA
GATCTTGTTGTTGACGAGGATGGCGCCGAGCGTGGGCTCGTGCAGGCGCTTGCGCCCCACGAGCACGGGCGCGCCCGGGAAGGCGTTCTGCGTGAACACG
GCGGCGAAGAGCGGCGTGGGCTTGGCCGGCTTGATGAGCGTCATGGTCATCTTGGCCGGCAGGTGCGGCGCCTCCCGCGGGATGAAGTCGAACTGGGTGG
TGGCCACGGAGAAGCCCCAGGGCAGGCGGCTCTGGTGCTTCTGCAGGTACTCGGTGTACTCCTGCCGCGACTCGAACACGAACGGGTGGCCGTGCGTCGA
CATGCAACGCGCCTGCAGCAGCGCACGCGGACGCAGCGACAGCGACGACAAGCGTAGGAGCGTCATGACCGGGAGGGAGGAGGTGGAGGTGGAGTGGGCG
GGCGGACGCCGCTTGGGAGGTGTGACCACCAACGGTTCAACGGGATCTGAGGATTTTTCCTGTGGC