Description :
From Genome Similarity Track
Location :
Scaffold_1487:1513- 3968
Transcript NameFunction/comments
Phyin_T30-4PITG_22171Kazal-type serine protease inhibitor%2C putative

Sequence
2455 bases(100 bases per row)
TGCCAACCCACTTATACATCTTGGGCCACCAGTACATCGAGCTCACCGAGCCATAGGTCTTCTCCCGACCTAAGTGCCCGCCCACGGGCGTATCATGAAC
CTCATAGAGGATTCGATACTTTAGATCCTCATCATGAGGAACGACTACACGAGGGTTATCCTCAGAGTCGGTGCTGTAGTACAGCAGGCCCGCCATCGAG
CGAGTATCGATGCAGCCCTCGCGCGTAAGCGCCCAGACAATTCCTTGTCAGAGTCTTTAAACTCTTCGCTCCCAAGAGCCCGTAGCAGCGCTACGCACAT
GTCGTCTTGTGCATACGCTCCGCGTATCAAGTCAGTCACAGACGCCTTCACTGTCGTGACATGAACTAACTCGTAGTCCGGCCTGCCCGAGAGCGCATCG
GCCACTCCATTAAGCCACACCGGCTTGTTCTTCACCTCGAAGTTATACTCGGCAAAGAAGGAAAGCCATCTTGCCCTTCTCTGAGAGTGATGAGACGACT
GTGTCGCAGTGCGTAACGACGCATGATCAGTAAAGATCACAAAAGGCTTAGAGCCTAGCAGGTGTACCCTGAATTTGACTAGAGCATACTTCATTGCAAG
TAGCTCTTTGTCATGAACGGAAAGCGAATGTTTCTTCTCTGCAGCTTTGAAGTTGGGGAGAATCCAAAGGGGAATCACGGCTTTCAGGCCCTCTTCGGGG
TCGGTCTGTTAATAAAAGCCACACACGAATGTCCAAATCCGGGAGGCGTTCACAGAAGCAGCTTAAAGGGACTGTCCGGGTCCGCGTAACGCCAGGAATC
GTAGCCTCGGAAAAGCCTCCTTTCACAGCCTCCAAAGGCTCCGTCGTGCTCGACGTTCCAGCACCATGTGCATCCTTCTAAAGAGATCTGATAATGCCCG
AGCCATCTCCGCGTAATTCGCGCTGTACTTGTGCAAGTAATTGGCTAAGCCTAGCCACTTGCGTAAGTCTTTTTGGTTCTTGGGAGCCGGCCAGTCCACG
ATGGCCTTGACTTTGGCAGGATCTGCCCGTAAGCCACGCTTTCCCAATGAAGCACCCGAGGAAAGGTATCTCCTCCGCGCCAAAGACGCACTTGTCAAAG
TTGGCATACAACTTATTAGTGCGCATGCACTCGAGCACCGCTCGCAAATAGTCAATGTGGTTCTCCACGTTTGACCTTCCGTGCTCAGCACGACTATGGA
CGAATATATCGTCACAATACGTCTGAGCGTACGCCCGGTGGGGCCTAAACAACTGCGTCACAAGGCGATTGAACCTTGCTGGTGCGTTCGACAGCCCCTA
AGGAAATGACCAGCCACTCCCAGAGCATACCGCTCGGAGTACTCACAACTGTCAGCGGAATGTCGCTCGCTCTCATGAGAAATTGGTAGTATCCATCGAC
CAAGTCGAGTGCACTGTACAACGTACAGCCCACCATGTTGCTCTGCAGAACATCCTTTCGAGGACGCAATCTCTTTAAAAAAAATTAACAAGTATTAAAA
TTAAGTTGCTTTTAAATAATAGTTTTTTATCTCTGAAGAATACCAGCGAAATTATCACTATAAACTTAACCGATATTGGAGCTACCATTAAAGTACCAAA
CAGAGGGGTGATGCAGCCTCCCTCAGCTCATCCGAAACAGAGTTTTAAGAATCCGTGCTAGTGCTTTAAAGTGTAAGCGCTTCAGAGGATGGCTTGAACA
TGACCTAACTAGCTATACTCAGAGCCATGTTGGTGCTCTCTTGATCATGCAGCGCTATACTTATGTGATAATATGCAAAATACTTGCAGGATTTGCGCGA
CATGACAGCCATCCCTAATATAATGTTATACAGTGCGTAGTGCGTAGCAAAAAGTTCTTGGTTTCGTGCTTTCCTTTTGATGAAGTTAATGATATGCAGC
ACCCAAGTATGCAGCGCAAACTCGCGCTTAAGTACGAGCTACTTGGTCCATCCCCACCCAAGTGAAAAACTGCATGTAAATGTGATGCAATATTGAAAAA
AAGCTACGCAAACCAAGTTGAATTTATCGACTTGCACACATTCAAAAAGGTCTTGTTCCGACTGGCTGAGGCCACGACGCTGCCAAAAAGTTACACGACA
GGCAGGATGCCGATCTTACCTGTTTTCTTCGAGCTGCAGGCGCCATCTTTCTCCACGATGTTCTGCTCCGGGTTCTTACAGGCAGCGATCTTGAGCTCAC
ACGGGTTCGAGTACCGGACACCGTCGGAGCCACAAACAGGTAATTCGACGTCAGGGCAGGCACTCGCACATTTCTTGCTAGGCGTCGAGTTGCCATCGTC
AATGACACCTTCTGAGTCGTCCTCGTAAATTTGTCCAATGCCGCTCGAGGTGGTTGACGATGACTTAGTAGACTTCTTCGCTTTACCAGAGTCCTTCGTA
CCCTCCACCATTTTAGTCGCTGGCGATGGGCTGCTGCTGTCTTCGCTAGCAGACT