Description :
From Genome Similarity Track
Location :
Scaffold_449:1513- 2565
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_449-fgenesh-gene-0.3Arabinan endo-1,5-alpha-L-arabinosidase A

Sequence
1052 bases(100 bases per row)
CGAACGTCTTACACAACGGGCCACCCCGTCGAGAAATCGATCTGGTTCCAGCCAAACTGCTTGTCGCCGTCGGCATATCCGATCCGCGTGTCGACTGCAG
TAGCACAACACCCCAACGATCAGTCAAGCAATCGGAGCACTCATATCCAAGAGTTGACGCACCATAGTGGTAGTAGAGCACCGGGCCGTACGTGGGGTCC
TCGTACACGCCTTGGCCGCCAGGACCGTAGACGTGGCCGTGCGACTCGAGCACGATGGTGCCGCCGCCGCTCGAGCACGCCGTGCCACTCTTGTCCTTGA
AGCCGCTGGTCGCGGACGACGAGCGGCACACCATGATCTTGTACTCCTTGCCAGACGTCGGCTTGGACGAGTCGTAGCCGCAGCACTGACCCTTGGAGTA
GAAGAGGTAGTAGTAGCTACCGTACTTGAACACGTAGGCTCCCTCCACCACCTCACCGTCCGAGGACGTCACCATGTTGTACGACGAGCCGCTCACACCC
GTCGGCGTCGACTTCATCTGAGCCTGGTAGATGCCTCCCCAGTAGCTGCCGAACGTCATGTAGTACGAGCTGCCGACCTGGATCAGGTTGGGATCGATCG
CGTTGTACGACTTGGACGATGAGCTCGTGATGCCGGCACTACCGTAGTCCGTCCACGTGCCATAGTCCATCGTGGACGAGCGAGCGAGGCCGATGGCAGA
GCTCTGAGAGCCGAACGTGCTCACCGAGTAGTAGAGGTAGTAGTAGTCTCCAACCTTCTGCACGTCTGGAGCCCACAGATCGTCGTTGCCATCCAGATTG
ATCTTGGAGCCGTCGGGCAGTGCCGCGCCGAGGTACGTCCATGGTCCGTACATGTGCGGCGCCGAGTGGATGGCGATCTTGCCGCCGGTCGAGAAGCGGA
AGTAGGTGCCATCGGATCGACGGATGATGGACGGGTCGTGCGCGTTCGAGCACGTTCCCTGGCAGAGCTTCGGGTTCGTGTACCCGCTGACTAGGCCGGC
GAGCAGCAGCGGCAGCCCGGCGAGGAGGGACAAGAGGCGAGGCATGACCACT