Description :
From Genome Similarity Track
Location :
Scaffold_41:15128- 17468
Sequence
2340 bases(100 bases per row)
TTGCTGATTTCAGCAAGCTTGTCAGCATGCTCTCTCCCACCAAGCCCAGAACCACGGAGTGGTAACGTGAGCAGAAGGCGGGGGTGCGTGAGGCTATTCA
CATAGAATGGAGTAAATCCGGTCGAGGCATGACCAGCGTTGTTCAACCCAAACTCAATGACAGGGAGCATCGAGCTCCAAGTCTTAGGCGACTCAGCACA
AATACTACGAAGGACGTCGCCAATGACGCGATTAACTCGCTCAGTTTGACCATCGGTCTGCGGATGGTCCGCTGTGGACATGTCTAATCGAGTGCCATGC
ACATTGAAGATGGAAGTCCAAAATTTGCCAGTGAAGCGAGGGTCGCAATCAGAGATGATTGCCAGCGGCAACCAGTTGACGAAACACACGATCGATAAAC
AGCATAGCTGTACCTTTGCCATCGATGGAATCCGGCACTGCCGCTAACTGAGCCATCTTACTTAAGCGGTCAACTAAGATCACAATTCCCGCATTGCCGT
CACTGTCTTTGGGAAGACCAAACACAAAATCCATACTGATGGACTCTTAACACCCCGTAGTCACAGGTAAACTGGCGAGTGGCGCAGCCGAATTTGCCGC
GGGTTTTACCCGCTGGCACGTTTCACATGTACGCACGTATGTGCCCACCCATTTGTAGAGTTTGGGCCACCAGTAGTGTTAACTCACAGAGCCATAAGTC
TTTTGCCGGCCAAAATGCTCACTGAGAGCAGTATCGTGGGCCTTAAAGAGGGTTCGGTACTTTAAATCCTGATTGTGAGGCGCAACAATGCGAGCGGTAT
CCGCTACATCTGTGCGATAACACAAGAGGCCATTATCGATGGAATATCGATACTGGCTGGCCTGCAAGCATGCCGATAATTGACTGTCCGAGTCCTTGTA
TTCCTCACTCCCAAGGGCATGAGATAATGCCACACAATGAGGATCCCGTGGATAGGCCACAAGAATGAGCTCCTCAATAGGAGACGATAAAGTCGTGAGA
TGAGCAAGCTTATAATCAGGTCTGCGAGAGAGGTCATCTGCCAACACATTTTGTTTGCCTGGCTTATACGTCACCTCGAAGTTATATTCCGCAAAGAAGG
AAATCCACCGAGCCATTCTCTGAGAGAGGTGAGGCGACTGTGTCGCCGCGCGTAATGACGCATGATCCGTATAGACGACAAATGTCTTGGAGCCAAGCAG
ATGGACTCTAAATTTGACGAGCGCATAATTAATAGCAAGTAGCTCTTTGTCATGAGCTGGATAGTTCTTTTCAGCAGCTTTCAGCTGACGAGATTCAAAT
GCGATAACTCGCTGGCTACCTGCAGCATCTGTTTGTAACAAGGCGCTGCCTATAGCAAAATCGGATGCATCGCAGACAATAATAAAGGGGTAATCAGTAT
TTGGCAACGCCAAAATGGGAGCATGGTGGAGACTCTCCTTTATTGCCCGAAATGCGTCAGCATGGGTGTTGTCCCAGCGCCAATCCGTGTTCTTCTTAAG
GGGATCAGTTAATGGCCGAGCCATATCAGCGTAATTTTCACTGTATTTGTGTAAGTAATTGGCAAGGCCAAGCCACTTACGCAAGTCCTTTTTATTCCTA
GTAATATGTCAGTCCACAATAGCCTTGACCTTGGCGGGATCCACTCGAAGGCCGCGCTTGCCAATGAAACAGCCGAGAAAAGGAATCTCCTCTGCACCAA
AAATGCATATAGACGCGTTATCGTACAATTTATTAGTGCGCATGCAATCGAGCAGGGCTTGCAAACGACTGATGTGATTTGCAGCATCTTACCGACCTTG
TTCGGCACTACTACGGACAAAAATGTCATCAAAGTACGTCTGTGCGTAATCTCTATGTGGGCGGAACGTTGCGTTACCAGACAATTAAATGTTGCCGGAG
CATTAGACAACCCCTGAGGCGTCACCGGGCATCACCAGCCATAGCATACCACTCGGAGTGCTCACTGCTGTAAGTGGAATATCACTCGCTTGCATGAGCA
ATTGATAATATCCATCGACCAAGTAGAGTGCACTATACATAGTACGACCAACCATGTTGTTTTGAAGAACATCCTTTCGAGAAATGGGTGTCTGTTCCGG
AATCGTATCCGAATTAAGCTTGTTATACGCATGCACAACACGCCACTTGCCGTTCGGATTTTTGACACAAAATGTCGGTGTCGAATATGGAGATTTACTC
TCACGTACCATCCCTGCCTCGTGCTTGGCACGTAAGAAGTCATCAATGACATCAAATTGCTCCTTAGGCAAGGGCCACTGTCTTGGGATACAGTATTTAG
TCCCAGGAACTTTGTCAGTTTCATGACGGACGTCTCTATC