Description :
From Genome Similarity Track
Location :
Scaffold_62:151269- 152452
Transcript NameFunction/comments
Sapdi_VS20SDRG_13665hypothetical protein

Sequence
1183 bases(100 bases per row)
GCCAAAGCACTCGCCATGCGAGAGCTCGCCGATGACGGGCCCGTAGAGGGCTTCGTGCTCGGAAGTGGATGATACAACTGGACTAGAACTTGGTACAAGT
TTGGAGCCTTCGGTGGTATCATGAACGTGAATCTGCAGCTGGCCGGCGGCAACAACCACGAGCTTCGCCAACGTGCTCTCTTGATGCAGCACGATTGCGT
TGGCAGGGAACGTTTGTACCACCTGTGGTCGCATGCTCCATGAACAGAAATGTAGGGTTGAATGTACCAGCTTGCAAGCGATCCGCTCGAGTGTCGGCCG
CGGAAGACATCGAAAGGTGTGAAAGTGGCTCAGGAATACCGAGAGCTTGGCGCTGTCCTCGCGCGACCGGCGGTGCTGCTCACACTGAGCGGCGTAGATG
TACTCGGCCGCGATTAATGAGCTGCTGCCGTACGTCAAGAGCGTCTTGTACGCGGTGGCCGAGAGCGTCACAACCTCTACGCATTGTCCAAACACTATTT
AGCGATTCGATCCTTGGGGTCAGTAGACGAGCACGAACTTGCGCGCGACTGCGTGAGGACCGTGGTGGCCCGCAGCACGTTGCCCAGCAGGGCGCCCTAG
ACACGAAGTGGAAAGGCAGTTGCTGTGTGCACGAGGTTTTCCGTCGTACCTCCCCAAAAACCTCGCCCACGGAAACCGTTTGAATACAGTCACCCATGTC
ACTGTCGTCCACTTCGCTGGCGTCGTAAAGGGCGTCGTGCGCTGCTACGCTCACAATGGCACTGTTCTTGTAGATGCTAACGACGCCGTCGAGAACGACG
TAGAGACTCCCAAAGCCCGTGATGCGGTCGCCTTGGCGATAGACAACTTGTCCGTCATGAAGTGTTCGATAGCGCAGCTTTTGGCACACGTCTACTTGAT
ACGATGAGTGAATACACCGGTGCAAACGTAGGAGCAACGTACACAGCTTGACAATGTACGGGAGGGAAGCAAAGAGGGCGATGCTCTCCACCAGCTCCAT
CTACGGGTGCTTGAGCACAAGCCACAAAACCAAATTCCGAGCGTACCAGCAGCTTCAAGTCGACGTCCGACCGGTATTGCTCTCTACACGGGATAAACCC
CATGACCACAGCTCGTGATCCAGAAGCCTACTGCTTCCTAGCGGCCGCATGAAACTGGCGGGTTTTCGCGGCCGACCATGTGC