Description :
From Genome Similarity Track
Location :
Scaffold_175:15123- 17838
Sequence
2715 bases(100 bases per row)
GTGCAAACTTTATGTCAGCCCGTGTACCATAAAGACGCCTATCCGTTCTGGCGTTGCCCACGGACGCTACCGCAAGACTTGCCCAGTACTTATACGGCGA
AGCAGCTGACCCTGACATTCGTGTCCGTTATGGCAGTAAAAGCTTCGCAACTGTAACGATACGCGCGTCCAGCTCGCTTGAGAGAGGAGACTGGATGGTC
GAGACCATGTATTAATGATATTAATTGACGTACACGTGATGTACGTGCTCGAGAAACAGTTCCCTGTGAGACGGCGATACCAGAATAGATATTTCCAATG
CCGCCCACTGGCGAGCCGTAGAAGCTACCGCTCTTTGCTAACATTCTATGACTATCACAACGGGTGATAATTATAGCTCCACATGATCGTTCGGATCAAG
CTTAGTGCTCCACAGAGCCGCTGACTACGACAACATTGTTTACTTTTAACTACGCATGTGTCTCTCGTGGATAGTGCGCCCACCTCATGTGCAAGATCGA
GTTTAAGCTTGGCGTAGTGACAGCTCTGAAAACGTCCCTCAGCGTATCCACCATATGCGCTGAAAGCAGTTAGCTAGACTTCGTAAGAAAAGCAGATCTG
GGAGAACGGATTTTGCGATACGTTCGGGTTGGTTCTCGTCAACCAATCTGCCTTACTTCCTTTGGCTTTTTATGGCAACACCTGGTTGCTGGACAACGAG
ACGACCACAAATGATCAAACTCGTGTCGTCGTGCTAAACACCAACGGTCATTAATAGGGCTCCGTCCCGCGCAGGACGGGATGGGACGCAGGATACTGCG
GACGAGATCAATGAGTATCTTACCCTGCATATATTTCGAAACGACCTTATCTGCAGACATATGAGCGCCTCTATATGCGCTGAGGGTACAAAAGGACAAG
AATAATACTGGAGCAGCAAAATAATCCGCTACGTGATCAATGCTTACCTACTACAAAAGTGTAGAAGCTGAATGCCTGTTCCACTAGATCCGATTTGGTG
CCGCTGATGGCGTACTTGTGCAAGCAATGCTCATCTTAAATGTGGCCGTAACGGAATTAGGAAGAATGACCACACGCATTAACATCAATGCAGTTGAGTT
CCAGCGAGTACAGACGTGATGATGGTCTTGACGAAAACTTTAAGCTGTGCGATTGCTCGAAAGCGATCTTGACGCTTGGTGGAATAGTAAAACCATTTGA
CGAGGCTTTAGAGAAATCATGTCACTGCCAAAAGAAACTTATCTTCCCAGAGATTGAAGTCGTGATCTTCAAGTATGTCCATCGGATCGTCGCTGGGGGC
AACCAAATCATCTTTACAAGCACCTATAATGCCTCGATGTATGCCTTGGCAGAATGGTCGAACAATGTCACTAAATTCTGAATTTGACAATTAATACATA
TAAAACAGATGACGCTTTCATTTTACCCTCTCTTGATTCCCAAAGAATCATATGAGTAGAAAATTAATAGAATCTTAATGCTACATAGTAAGAAAATTAT
AGAGTGCGGGATGTGCGCAGGATTGGTCATGGCTCATCCCACATCCCATCCCGCGCGGGATGGGATGTGGGACGCGCAAGATGGGACGTTGCGGGACGGA
GCCCTATTCACCAACATAGCCACTTTATAAAAATCAGGCTATTGAATTTGAATCGAAAATACCAGAACGAGGCGAAATGATCAAATTAAGGCTAGTGATA
AACGGCTGATTTCATTTTTATTCGGCTGGGTCTTTTTTAGGTATAGAGTAAAAAGTCGTTATTTACATGTTGTAGAATATCGTTTAATTACTATTTTTTT
TAAATTGACTGTTGGTGACCCTCTCGCCAAAGGGGAATTCTCGTGATAGCTCTCGCGTTTCAAGTACGATGTAAAATTTGTTAGAAACTGCATTTATGCA
GTTTTGTATAGTCGCATCACACTAGTGTCGAGCATGCTTGAAGAGGCAGGCAAGGTCAGTTGAAATAGCGTCTAACGACTTAGACCCTATGGATTTTTTA
GCTTCGGTTGCTGAAATCAGCTTTAATGGACACAAGCGATAGCGAGGAAAGACAGATAACGTAGGCGCAACACCAACGGCAGAATCCACAACGCTATTGA
ACTTTTCTTATTTGGCTAGCAATATTGGCTATCGAACCCAATTACCTCCTATTAGATAAGTGTTGATGTTCTAGTCTGTGCGCCCACTTCCGACACTCGC
AGGGGCTCTTTGCGAGATCGAAAACACATACGTTTGTGTATTTACGACTCAAGTACGATTACCAATTGCCGCGTTCAATTTTACTATGCGAATTTGCTGC
TTGTTGAGACAACTGCGGCAATTCGAACAGTGTAAATTTCTCGATAATAGCAATTGTAATTGAATAATGACGTAAGAGCGTGCCAGAAACAAACGTTCAG
GCAATATATATCGCCCCACCATAAGTGCTCGCGGTCGCGCGGATGCATCATGCTTGGTGGATCTGTTGACTGTGTAGCTTTGATGGCGTCAAAAAGCGAC
GTCGTCCTCAGTATGGAATGTTAACAGCGGAAGGAAGGACTGGGTAGGGTATTAGCCTGTTCGCACCGATATCGTCGTTATGAGCTTAAATGGGCAAGTA
AATAAATAGTGATACCAGGTTGAGTAAACGGGATCTACTGTTGACGAAGCTAGGCATACTTCTGAGTTACTTTCGAGTTACAGTGCTCCCTCTGATAACT
TTTCCTCCGATAACT