Description :
From Genome Similarity Track
Location :
Scaffold_824:15123- 16454
Sequence
1331 bases(100 bases per row)
TAAAAAACGGTTTGATGTGAACATTTGGCTGTGCcagaagatgctgcgcttccttGATGCCAATAATCGAGAATatcgacgacgtcaacaGCACCGCAAT
ATTTCGACGGGGCATATCAGGAGGAGCGTGATTATTGACAAGTCTGTAGCGCCAGACCAATCTAGAGAAGAAGACCCTGTTGTGAACTCAATTCGTGATG
AAACTACGTATTTCAGCTTTGGTTCAATGGTTGATGAAGATAGCGGCGATCACAATGTGGAAAATACATGGATTGAAGCATCGAGCTTAATAGttcagcc
acagcagcatAATTTCGTTGACATTCTTGTTCGCAAGTCAAACGACTACGTATCGATGACGCAGTGGACAGCCTGTGTGAAAATGTTCCCAACGTTATTT
CCAGGAGGCTATGGTGGTCCATCCGAAGCTCGTGCTAAGAAAATGTCAGTCCGCAAATGGATTCTACGGTGCTTGCGAATTCATGGTCATCACTTTGAGA
AGCATTATGCGTTCATGCTGTTAGCATTCGACTACTTGGCATCCCAAAATGCGAGGGAGACGCTGTATCTGAAAATGAACGTAAAGCGTCAGGCACTCAA
AGCAGCTGAAGTGAAGCGGAGCACGGTTCTCCAAGCCATCAAGTATTTTAACTACTTGTCTAAATGTCGTGCGACAGGCATCAAACCTCGCCCGCCAGTA
GTGGAAGTTCAACGAGTAATCGACTTGAGAAAAGGGCTGCGTGTGCCAGAATCCGTCTTTTACGGGTCCAACATAGGTCGCATGCGGGCACGACACGACT
TGTTTGGACTGCTCAAAAGATTTGGCCCTCTTCAAATTTTCTTCACGATTTCTCCTGACTCAGCCGGCACGTACAATATTGCCGTGAAGTCTGGTGTGCT
TTCGGAGTGAGCTGTAGATGATGCCGATGTCCTACTAATGCCAAATCGAGCTGGACGGAAAGCGACTGCATCTTCCTATCCTGTTGAATGCGCATGACAT
TTTCTAAGCGTGATGAACACGGTGATTGATGTGATTCTAGGGTGGGATCAGAAAGCAAAAGCTCCCAAGCGGGGAGGCGGAATTTTTGATGCTGTACGCG
CTTTTGGGGCTGCGACTGAAACTCAACTTGCTGGTGACTTGCATGCGCACTTTGCAGTTTGGTTGTACGGATTTCCTAGTACAGCATCGGATTTAGGCGA
TGAAATTGCTGACGATAGTGTATTTTACGACCGACTAATGCTGCTAGCAGATACACTGTTGACAACAAAACCTCCGTGTTTGAGTGAGGAGACTCCGTGT
ATTCGGTGCCATGAAGATGGCACATTGAAAC