Description :
From Genome Similarity Track
Location :
contig_69:15122- 16654
Transcript NameFunction/comments
g9864.t1hypothetical protein

Sequence
1532 bases(100 bases per row)
CTTCCTCTGTGCAAGCTGCTGTGTGCCCCGTCACACTTGGTAGCACTTGTAGTCAATCCACGCCTACGCGGGTAGGATTGAACTACCTGAATCCTCTGTG
ATCTCAAAGCCTGAGCCACTATGGAACGAAGTGAGTTTCCTCACTTGAACGACTCGCAGTTCCAGTCCGTTCGAAAGATGGGAGGCATCTTTGGGAGGGA
TGTCCTCCGAGGCTTGGCGTCCTTGACGGCAGCCGAGCAAGTCGAACGCGTTCGACACGTATGAGCGTGAGCTCATTGCTCACGTGCAGAGAAACCTGGA
GGCCTCTGTGGCCGAGCCGAAGCCTGTCCAGCCGAAGCCTTTGCGGCTGGCTGTGCCTGCGTTCGAAGGAAAGGAAGGTGAAAACCTTCACTTCTGGATC
CGAGAAGTTGAGATCGCCATGAGGGCGGGTCTCATCTCGGATCAGGGACTTCGCATTGCGTTCGCGTTGTCCAACCTAAGCGGTCGTGCCAAGAATTGGG
CGTACACGCTGGAGACGACGTCTCCTGAATGCTTGGCATCCTGGGAACAGTTGTGCGAGCGGCTTCGCGCTGCGTTTCTCCCGGCGAACGATGGGTTTCG
CCAGCGCTCACGCTTCCTCGCCTGTAAGCAAGGGAAGCGCGAGCTGTACGAGTACGTACAAGAGATGCGCACGTTGGCATCATCGTTGGTGGGGAACCCC
TGCCCGAAGACGTCAAGACGACGGTCTTCATGGACGGCCTGAAGGTCGGTCCCGCACGCACGCAGTTATTCCGCGCGCATGCATCCACTATGAGGAGGCG
GTTAAGATCGCCCTCCAGGAGGAGTACAGCCATAAACAGGCTGGCACTCCGGTTGTTGCGCAACTTGTCGTTGCGAACAACGAGCTAGAGCCTATGGACT
TGAGCTCTGTTGAACTTGGCTCGGTCGGCTGCTATAAATGCGGCGGACTAGGACACTACCAACGTGTGTGTCCTTCGACTGGGGTGGGGAAGAACCCATC
CCTCAAACCCCGAGGGCCTAACGGTCGCTGGCGCAAGCCGCGGCCAGGTAGCCGAGGGAACGCCGGCCACAAGTAATGGCGGGTTCCCCAGAGGGGGGAG
AGTTGAGTCTCCGTGACGGGTGTGCGGGTAGTGCACACCATGGAGGCTTAGCCTACGAGAGACATTATGTCTCGAATCGGTGATGGCAACGCTGGGTTGC
CGTTAGTACACGTGAGTGTACGGGGATGTTAATATCCCTAGGAACGTTTAGTTCCAGGGGCGCCGAATGCTTTCGTACACCGCCGGAGCGATTGCCAACT
CTCTGTGAGAGAGCATCGGCAATGGTCTGCATAGACCTTGCTGTCAGGTTCACATACCTGAACAGCTGCGACCCGTACGTGGTCGTGGACACGTAGGGCG
TCCGCTTGGGTGCGCCGTGCCATGGACGCACGCACCCTGAAGCAATTGGTGTCGGAAAGCCATCGAGTCTAGCCGGCACCCAGCCTCTGGCAGAGCATTG
GTGAGTCATGACCCCACCTCTGCCAGAACACA