Description :
From Genome Similarity Track
Location :
Scaffold_304:1512- 2529
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_16415calpain-5

Sequence
1017 bases(100 bases per row)
CTTATTGACGACCAGCTCTTTGTGTCGGAAACGGACTTTGACCACGCCGACTCGGGCGGGATGGCCATGACCAAGAAGACCTTCAACGCGACGTTTCGGT
CCGGCTCGTCGAGTCTAAGCTTTGCCAAAGCCGCGTCGCCCAACGAGACGTGGCTGCCGCTCCTCGAGAAAGCGTACGCGAAGCTCCATGGCGACTACAA
GTCGATCGAGGCGGGATTGACGGGCGAAGCGCTTGAAGACCTCACGGGCGGTGTCACGACGCGAACTTATCTGAAAGACGTCTCAGACCATGACGCGCTG
TGGCAACACGATCTCATTGGCCATCTCCACGTCGACGCGCTGTTTGCCGCGTCGATCGAGACCAAGCACTCGTACCCGGACTTGGCCTCGAGCAATGGGT
TGCTGCATTTGCACCCATACGCGGTGCTGCGCGCGGTCGACGTTGGCGGCCACCGACTTGTCCAGCTGCGCAATCCGCAGAAAGGGCATGAATGGACCGG
CGACTGGTCGGATAGCTCCGAGCTCTGGACCGCCGAGATGATTTCCGCGCTTGGCCACACCGGCGGGGACGATGGCTGCTTCTGGATGTCCTGGACGGAC
TTCCTCGACGAGTTTACCCACCTCGAGCGCACGTGGGTCGATGACGCCGCCACGTCACTCGCTGTGCGCGGGAGACCGTGGGTGACACTGCGTGCGGAAT
GGCCGGCGACGTGGCAGCCGTCAGTGTTTACGTTTGATGGCCCCGACGTGCTCTCACGGGTCACGCTCGTGCTGCAGCAAGCCGACACGCGCCGCTTTGT
GGGCCTCGAAGGCAGCTACAAGTTTGGTCTTCGCTGCGCTTTGTACCGCAGCCCAGACGCCGCGACCAAAAAGAAGCGGGTCCTCGTCGGCCAATATACC
CAAAACGCCTTCGACCGCAGCGCCAGCCTGCAAGTCGTGCTCCGCCCGGGCCAGTACGAGCTCGATGTGATGGTTCTCCGCACGGCCTCGGGGCGCGCGT
CGATCGAGGAGGTCATT