Description :
From Genome Similarity Track
Location :
Scaffold_60:151167- 155910
Sequence
4743 bases(100 bases per row)
ACTTGTACGCTTCCTCATCACTACGTGTAAGCAAGTAACGGACACCCCAGGCCCGTTACACCTGGTAGCACTTTGTAGTCCTTTTCATGACCAAGTTCAC
GATGAGCCAAGGCATGACGTCTGAAACTCCAGGGCCGACCCTGGAACATGCTGCTTTCCCTCATCTCACTCGTGTCGAGTGGGAAGCCCTTCACCGCCTC
GCGGCGGTGTCTGGTGAGGCTGTAATCGCGTCGCTGCTAAGCTCAGCGACGTCCGACCAACAACGCGAAGCAGCCCAAGAGTTCATGGAACGCGAGCTAG
CCGATGCGAATCGGCGAGCAACAACTCCCGCGCGTTCCTCGAAAAATGATGTCGTGAAGCTAGAGACGTCTACCTACTCCGGTGAAGGAGCGAATCGCCT
CCCGCTGAACCGGTGGTTTCGCGAGGTCGACATCGCGATTGCTTCGAGAATGATCGAAGCGCAAGGGTCAAAGGTCAATTTCTTATTGTCCCGGTTGTCC
GGGAAGGCCAAGGAATGGGCCCTCGGTAAACTTGTCGTTGATCACGACGCATTCCCCACTCTGGAGTCTCTCCAGAAAGATCTCAGGCTCGCGTTCGAGC
CCCCTCAAGACGAGTCCCGTGTGCGTGCCGAGTTCTTCGCCCTTCGTCAAGGTAAAACGACTATGCGCGACTACGTTCAAAAGGCTCGCCACCTCGCGTC
ATGCATCGTGACAAATCCGATTGACACAGCATCGCAGTCCATGTATTCGTATCCGCATGCGTGAAGCATGACACGTACTGCCTGAACCGAGCGGAACCTT
CTCTTCTCGAGGAAGCATTCGCCCTCGCGGTTACGCGAAGACTACGATGTGGCGGCGTCTTACGCGCGCGATGTCAACCGGCAGCTCGTGAGTCAGCCCC
CGAGCCCATGAGATCGACGCGATTGACGCATCGAATAATCATCGTCAGTCGACTCCTCGTGGGCCCAACGACCGTCCTAATCGGCCCGCTCACTTGCTTC
CGCTGCCGGAAGATCGGTCATCGCGCGGCGGAATGCCGCGCGCCAGCGCCGGTACTCGCGCACATGTCTGAAGTCTCACCTGCCGTTCAGTCAAAAAACG
GTCAGGGCCAGTAGGTGCGGGGCGCCCTACTGGCTGGAATGGAGGTCCGGGCCCCCCGGTGGCTACCCAACCTTCTAGCCCTCCTGTGCTCCACGCACAC
TTTAATGCCACCACCACGTCGGGCGACTCGAGGCTGATCATCGTCAGTCTTCATGTCGCCGGCGCCCGGCGACCACTTCGCGCGCTCCTGGACTCAGGAG
CGTCGAATAACTTCTTTCGCGAATCGTGCTTATCGATGCTTCCAAGAGAGATCGCAGTCCGTAATGGTCGAGGTCAGGTCGTCGTCAAACTTGCTGACGG
GTAGCCACGCCGCGTTGCGCGGCGCGAAATCACGTTGCCATACACATTCGACGGCTTCCGCAGCAACGACGACTTCCTCGTGATTGAGATGAACTATGCG
TTCGACTGCATCTTGGGTATCCCGTGGTTGTCACGATATCAACCAGAGATTGACTGGTTGGCTCGGTCGGTTAAACACCGCTCTGGCTTCGATGTGAGTG
AGGTGTTCACACACCTCCTGGTTGCCCAGAAGGACTGGCCCCCATGTCAGGGTCGTGGAGCGGTTGTCCATAATGCAGGTTGTGCAGAGAGCGAGCGATG
GCCCTCTCTGTTTGTCTTGCACAGCGCTGTTGCGCGAAAACCCCTCGCTGCGAAGCGAGGTTGTTAACACTTTGGCGGTAGAGCAGGGGCTCCCGCAATC
CGAGCAGACGGTCGAGCATGAGTTCCCGTCACGCAACACGGCGGTCGAGCATGAGTTCCCGTCACGCAACACGACGGTCGAGCATGGGTTCCCGTCACGC
AACACGGCGGTCGAGCATGAGTTCCCGTCACGCAACACGACGGTCGAGCATGAGTTCCCGTCACGCAACACGACGGTCGAGCATGGGTTCCCGCAACACA
CCAAGGCGGTTGAGCATGGGTTCCCGCAAAACACTCTAGCGGGTGAGCAGAGGTTCCCGCAACGCGATTCGGCGGTCGAGCAGTTGGAGCTTCCGTCATC
CACAGCGGTGGTCGAGCAGTTGACACTCCCACCGGCTACGACGGCGATCGAGCAGGGGCTCTCGCCAGTCGATGGCGCGGTCGAGCATCGAGAGCTCCCG
CGCACTACCGACACGGTTGATGGTGCCCCTCCGTGTCTAGAGGGGGGTGATCCCTCGTCCAGCGATAGCAAGTCTTCTGTCTCGAGCAGCGGTTCGAGAC
GCCGCAAGAAGAAATCCAAGCGACGCCGCCTTAAGCGACGTGGTCAGCCCACCGCCGATATCGCAGTGAATGAGTCCATACACGTCCTGGAACACGTGGA
AGGAGGCGTCGTTCGCTCACGCACACTTGACATTGAGAGCCCACCTCGCGAAGCTTCTTCCATCACACGCCTTCCGGGTCTTTCCTGGAAGCATTTTCTG
CGCGATCTGAAGTCAGGAGACATCGAGCAGGTCTGCTTGATCACCGAGTCTGCCTCGGCGGAAGAGATCCACACGGTCGCTACCGACAATCTTCCACTTC
GTCCAAAGAACGCTGAGCCGAAGTCGGCGCGCGAAGAGCGCTTCGCTGCCCAGTCGTGGGAGTCACTCCGCGACTCGGGCAATCCAGTATACGACACCGT
CCGCGAGTTCGCGGATGTTTTTCCCGACAAGATTCCAGCTGAGCTCCCTGCTGACAGAGGCATTCGCCATGAGATTGATCTCACGCCGGGTTCCAAGTAC
TGTGTGACGCGACAGTGGCCCCTCCCACGCGATCAGGTTAAAGCCATTGACGACTTCTTCGAGTGCCGCCGCAAAGCGGATCACGTGCGCGAGAGTACCT
CGCCACACTCGAGTCCGACGTTCTGCGTGAAGAAGGCCACGGGTGGTTGGCGCATTGTTCACGCTTTTAACAAGCTAAACGACGCCACCATTCCAGCACA
AACGCCGATCCCTCGGAAGGATATGGTACTTGACACCATGGGCCGCAGTGTTATTTTCAGCACCATCGACCTGACCGATGGCTTCTATCAGATCTTGATG
CGACTCAGCGACGTCCCGCTCACAGCGGTGAGCACTCCCAGCGGGATGCTGTGGGAGTGGCTTGTCATGCCGCAGGGCCTGAAAAACGCACCAGCCACGT
TCAATCGCATGGTTTCCCACGTTCTGCGCCCACTTCGCGACTTCGCTCCGAGCTACTTCGATGACATCTTCGTTCACAGCCGCGCTGAGGGCGATCTTAG
CGCCACAGAAGCTCACTTAAATCACTTACGACAAGTGTTCCAAGTCATGCGCGAAAACAAAACTGTACGCGAACTTGAAGAAGTGCATCTTCTGTGCCCC
GGAGATTCCGGTGCTTGGCTGTTATGTGAGCAAAAATGGTGTCCGAGCGGATCCTGAGAAGGTCTCGTCCATTTGTGCGTGGCCCACGCCGCAGAATCAG
ACTGAATTGCGTCAGTGGCTTGGCCTCGCAAATTATCTCCACAAGTACACGAAAAATTATGCTGGTCTGATCCAGCCATTGTCTTCATTGCTGAAGAAAG
ACATCACGTGGTCGTGGACTCCCGAACATCAGTCAGCCTTTAATGCAGTGAAGAAAAGCTTACCGGAGGCCCCAATCCTGGCGCTTCCAGATGATGCAAA
GCCATTCCACGTTGTTTGCGACGCGAGCGACTTCGCCATCGGCTGTGCACTGATGCAGTTCGACGACGAAGGTCGCGAACGCGTCGTGAGCTACCAATCC
AGACAGATGAAGCCCGCTGAGAAGAATTATCCGGTCCACGACAAGTAACTCCTTGCGATGCGCTACGCACTGATCAAATTCAGAGTGTACTTACTCGGTG
AGCAGACATTCGCGATCTACACAGATCACGCGTCGCTGCGAACAGCGACGAAGAGCCCTCATCTCTCTCAGCGCATGGCACGATGGCTGTCATTCTTCTC
CGAGTACAACTTCGTCGTTCACTACAAGCCAGGCAAGAATAACATCCTTGCGGATGCCCTATCTCGGCGCCCCGATTACGATCCACGCCGAGATTTGGGT
CGTCAGTCACTTGAAGACGCGGACGACGACGAATTGGACTGCGCCACATGTGTGGCTGCAGGTGTGAGCCTGATGACGGCGGTATCTCCAATACTTCCCC
TGCGGGAAGAGATCTCTGCCGCGTATCGAGATGACTCGATATATGCCGGTATCCTGGAACACCTTCGCACACCAAGTGATGCCACGCTAAAGACACTGAG
CCGCTCCACGCGCGACCAGATTCACAGATACCAACTTGACGGTGATCTACTGATGTACAGTGTCGATCGATTCGATGCTCCTCGCGTCGTTGTCCCCAAC
GACCCCGATCTACGCGCAAGAATTATACACGAATTCCATGACACTCCAGAGGGTGGCCACTTGGGCCGTGAGAAGACTTTCGCAGCGGTATCCCGCGACT
TCTACTGGCCTCACCTATACAAGTGGGTGCGCAAGTGGGTCCGCTCCTGCGAAACTTGTCAACGCGTTAAGCCGTCACCGTCATCGCAAGCTCCGCTGCG
TTCTCTCCCTCTGGCGACAGAGGCGTGGCGCTCTGTGTCAATGGACTTCATATTCGGTCTCCCACCCGATACTGACGGTCGTACGGGTGTTCTGGTCTTC
GTGGATCGCTTTAGCAAGATGTGCCATCTCGTTCCGGTTCCGG