Description :
From Genome Similarity Track
Location :
Scaffold_57:151141- 152779
Sequence
1638 bases(100 bases per row)
AGTTCCCCGGCGACGTTCAACCGCCTGGTGACGCAATTGTTCAGGCCACTGCACGACTTCGTACAGACGTACTTCGACGATATCCTCGTCCATAGCCGTG
CCGAGGGAGGAAAAACGACCATGGAGGTGTATCTGGGGCACCTCCGTCGAGTGTTGGACGTGGTACGAGCGAACAAGCTCTACGCCAACATCGACAAGTG
CGTCATCGCGTCACCAGAGATTAAGGCTCTCGGCTGCTTTGTAAGCAACGTGGGCGTTCGGGCTGACCTAGACAAGGTCAAGGCCATAGCAGCATGGCCA
ACGCCCCGATCCCAGAAGGATCTTCGAAGGTGGTTGGGTTTGGCCAACTACCTTCACAAGTACAGTGCAGGATACGCGGGCTTCGCTAATTCCTTGTCGG
GTCTCCTTCAGAAGGACATCGACTGGCGCTGGGAGCAAGAGCACCAGGATGTCTTTGACAGCATCAAGGCCAGTCTGCAAGATGCCCCTGCCGAACGAGA
CGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGACTATGCCATCGGGTGTGCACTGCTGCAGGCCGACACGGCTGGACATGAACGAGTCATCTTGTTCCA
GTCCAGGCAGCTCAAAGCTGCCCAACGGAATTACCCTGTCCACGACAAGGAGCTCCTGGTAATATAGAATGCCCTTGTGAAGTTTGGGCTCACCTTCTGG
GCGCACGGCCCTTCGTGATCTACACAGACCAAGCATCCTTGAGGACGGCGACAAATTCGCCTCACCTCTCCCAACGGATGGCGAGGTGGCTGTCCTTCTT
CGCGGAGTACAACGTCCGCGTCAAGTACAGGCCGGGCAAACTCAACGTGCTTGCGGGCGCCCTCGCTCAGCGTCCAGACTATGAACCTCCACGGGTGGTC
GTACCCAACGACGAGAATCTGAAGTTCGACATCCTCGCGGAGGCGCACGACGCGCCCTCCAGCGGCCACTTGGGTTGCGAGAAGACCTTCCTGTCGATCG
CTCAGGCCTTCAGGTGGACCCACATGAACAAGTGGGTCGCCCGATACGTGAAGACATGTGAAACATGTCAGCGGGTCAAATCCGCAGGGCACGCTTCGGC
TGCACTACAGAGCCTGCCCGTTCCAGCTGCCTGTTGGAAGTCGATGAGTCTTGTCTTCATCTTTGGGCATTCCGCCGACGGACACGGCAACACCGGAATT
TTGGTTTCGTGTGTCGGCTGAACAAGATGGTACATCTCGCTCCAGTACACGTTACAGTCACAGGCGAACAAACCGCGAGGTTGCTCGCCGATGGCGTGTT
CCGCTATCACGGTCTCCCGGAGAAGATTGTCTCGGACCGAGACCCGCGATTCACGGCCGCGTTTTGAAAAACGCTGTTTCCTTTACTGAGAACTCGTCTG
CAGATGTCGACTGCGAACCATTCACAGACGGACGGCCAGACGGAGCGCGTCAATCGAGTGCTTGAGGACACTCTGTGCAGTGTGTGCGCGAAAGCACCAC
GCACGTGGTCGACGCAGCTTCCTGTAGTTGATTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCATTCTAGTTGAACGGCTTCCGTCA
CCCCAGAGTGTCTCTCACTCTTCGAGGGGACACTGTGG