Description :
From Genome Similarity Track
Location :
Scaffold_1902:1511- 3567
Sequence
2056 bases(100 bases per row)
AACGCCAAACAGCTGCGACAATGGCTGGGTCTGGCCAACTACTTGCACAAGTACACGCGCAATTATGCAGCGTTAGTGCAACCGCTCACGAAGCTCCTGA
AGAAGGATATTGAGTGGGAATGGTCCAGTGACCTTTCGGCAGCATTTGCCGAAGTGAAAAGGAGTCTGCGAGAAGCTCCTGTGTTGGCTCTTCCAAATCA
CGAGAAACCATTCCATGTGGTTTGTGATGCGAGCGACTATGCCATCGGTTGTGCTTTGATGCAACACGATGATGAGGGTCAAGAGCGAGTTGTATCGTAT
CAGTCACGACAACTCCGACCCGCAGAATGGAACTACCCAGTTCATGACAAAGAACTTCTAGCAATGAAGTATTCTTTAGTCAAGTTTCTTATCTATTTGC
TCAGCGAGGAGCGCTTCGTGATCTATACTGATCATGCATCGCTGCGAACAGCGGTAAAGACTCCTCATTTGTCGCAAAGAATGGCGAGATGGTTCTCCTT
CTTTGCAGAGTACAACTTTGTTGTGCACTACAAGCCAGGTAAGACGAACATCTTAGCTGATGCGCTGTCAAGACGTCCGGACTACGATCCAATGATGAAG
AACGAAGAAACGGACGGAGCTTGTCGACAGTGTGAAGATGTTCAAGCGATTGCAGTTCAAGCTACGACGACAGTGCGAGAAGAGATTCTCGAAGGGTATA
AGTCTGACGAGATATGTCAAGACCTCCTCAAGTATCTCAAGGACCCTTCTGTCAAGGCACTGCAGAGCTTGCCTGCTCGAACAAGATCGAGAGTTCATCG
CTTCCGAGTACACAATGGGTTGTTGTACTACGCGGTGGAAGTTGAGGATACAGCACGAGTTGTTGTTCCCAACGATGAAGGACTACGTCATCGACTCTTG
TATGAGTACCATGATAGTCCTTCGGGTGACCATCTCGGACGTGAGAAAACGTTTCTCAGTCTTTCCCGGGATTACTGCTGGCCACACATGTACAAGTGGG
CTCGCAAGTATGTGAGGACTTGCGAGATCTGACAACGAGTGAAACCTTCTAGTTCCACGCAGGCCCTACTTCGTCCGCTGGCTTTCCCGTCGGACAATTG
GAGGTCTGTGAGTATGGATTTCATATTCGGTCTTCCACGTGACACACATGGACGCAACGGCATCCTTGTGTTTGTGGACCGATTCAGCAAGATGGTCATC
TTGCGCCTGTTTCGAACAAGATCTCGGCTGAGAAGGCTGCACAGATCTTTGTTGACGTTGTACTCCATCTGCATGGCCTGCCAGTCGAGATCGTGTCTGA
CCGTGACACCCATTTCACTTCGAAGTTCTGGCATGCACTATTCGGACTTCTGGACACCAAGTTGTCCATGTCAACAGCGGCACACCTTGAATGGACGATC
AAACAGAACGAGCGAATCGATTCCTGGAGGACGTGTTGTGCAGCTACGCGACGTCTTTCAAAGAGTGGAGCGAGTTTCTCCCTCTTTGCGAGTTTGCGCT
GAACAACTACACGCATGTCTCGACAGGTCACTCTCCACTTTATGTGAAATATGGCATTCATTCTCGAGTGCCTGCTTCTATAATGGATGAGGTCTCTACC
TTAAGTGGAGGAGGGACTACGGCTCACGGAAACAAGCCGAAGTAGTCTTACGATCTGAACGCTTCTTCCGAGTTAAAAGCGAATTTTGACTCGATGAAAC
CCCTCCACGATCTAACAACTCGTGAAGAGCAGCACATCGATGACTTTATTGTGAGGAAACAAGCCGTTGTGGGTTTGTTCGAGACGCGATTGCAAAGGCT
CAGGATTTGCAAAAAAAAATAAGCAGACAAGAGTGAAAGGGAGAACAAGCAAGTGTACTCGAGCAATGATCTTGTATTGCTTAGTACGGTTAACAAGCTT
GAACATGCAATGTCCAACTTGGGAAGCTTGAAGCTTCTGCCAAGGTTCATTGGACCGTTCAAGGTAGTGAAATGCAATGGTGATGCCTACACGCTAGACA
TACCTACACGTATGCGTCTACATCCTGCATTTTATGTGGGTAGACTGAAAACGTAC