Description :
From Genome Similarity Track
Location :
Scaffold_176:15108- 21571
Transcript NameFunction/comments
Physo_144280reverse transcriptase

Sequence
6463 bases(100 bases per row)
AGTGCTGTTAACAGCAGCGCTCGCATTACGTTCCAGTATGTAGCGCGTGGTGGGCTTCGTATACCCTCACCAAGTCTGGAACGTCTTGGAGCAAGACGTT
CCGTGGCTCCTATGTATCTTGGTTGGGAGGAAATCCTCTCCAACGAATACGAAAACAAACTGGTTGCCTGTTCGTTCTCGGGATACTGTGATCAACAATC
CGATCAACAATTCATCGAGTTGAGCCGTGTGCATCGCGAATTGGCGGCGGCGGTGGCGGAAACACACCCCGTGTGTGGTCAACTTGGTGTTGACTCTGAT
CTCGCGTCTCCCCACGACCAAGTCCCGGTCGTGGAGTAGTTCCAGAGCGCTGCGTTCGGCGCTCTGAAGTATTCGCAGTTTGCGGCGGCCTCCCAGACCG
CATCGATCGTTTCGGCCGAGCTGGACCATTAGCTCGACCCGCTGCTCCAGCGCGAAGTCGCGCTGGAGAGGATGACGGCATCCGCGGATTCTTCTGATTC
GGTTCAGCCGAGCTAGGTAGCTCGAGCTGCAGGTATGGCTTCAGCCTTCCGACGTAGAACGTCGGATGGAGACACATACTATACGGTATGTCCAGTGTGT
AGGCGTTGCCGTGCCGTGCCAGCACAGTGAACGGCCCGATGAAGCGCGGAGCGAGCTTGCTCGCCCCGAAGTCGGAAACGACATGTTTAGGCAAGTTTTG
AGTAGCTAACAAGACTAATGAACCCTTCTCGAATTCATTAGTGTTGCCCCTGCCAACATTGTCTGCGTTCAGCTTCTGTCGGTCGACAGAAGCTGCAATA
GCGTCTTGGACAAACCGAATGACGGCTTGTCTGCGCTGTACGAAGTGAATTGCGTCCGAACTGAACTCGTTCAGCTCGCTTTCAGCAGTAGGCCCTGCCT
CTGCGTTGGTCTTCGTGGTGTATGTGCCCTGCACAGACACGCTCTTCTTCTGCTTGTTCTTGTCAGTGTCTGTGCCCCGCACAGACACGTTCTTCGTGCG
CTTGTCGGCGTCTGTGCCCTGCACAGACGCGCGGTTCTCGGCTTTACTTCGTGTCGTTGCGGCTGACACTGTGCAAGTGTCAGCGGCATTCTGCGGCTGC
TGCGTTGCAGTCGGAGATCCTCCCCCACTTAAGGAAGGAGTCACCATCCCGAGTAGGCTCGGGAGGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTG
TATGCCCGGTCGAGGCATGCACCGAGTTGTTGATGGCGAACTCTGCCATCGGCAGGCACTCGCTCCAGTGTTGGATCGAGTGAGCGTAGCTCTTTAGCAC
GTCAACGAGCACGCGATTCACGCGCTCGGTCTGCCCGTCCGTCTGAGGATGGTCCGCAGTCGACATCGAGAGTTGACTCCCAAGAAGTGTAAATACTTCT
TGCCAAAGGTGTGCAGTGAAGCGCGGGTTCCGATCCGACACAATGTCGATCGGGATGCCATGGTGTTTGAACACCATGTCGACGAACAGACGTGCAGTCT
GTTTCGCAGTCACTTCAGCGGGTACAGCAGCAAGATGGTACATCTTGCTGAAGCGGCCAACAAAGACACAACGCCTGTGTTCCCCTGGCTGTCCGGGGGA
AGACCGAATACGAAGTCCAAAGACATGGACTGCCAACACTCCGACGGAGTCGGGAGTGACTGCAAGGGAGCCTGCGCGAACGGCGCAGGCTTCACACGTT
GACAAACTTCGCAAGCACGGACGTACTTGCGCACCCATTTGTACTGGTGGGCCCAGTAGAAGTCACGCGTGAGAAGAAGGTATGTCTTCTCACGACCCGG
ATGCCCCGCAGTCGGCGCATCGTGATACTCATACATGATCCTGTGTCGCAGGTCATGGTCATAGGGCACGACAACGCGGTCCGCGTTGTCGTCGACTGCA
CTGTAGAGTAATAACCCGTCGTGCACCCGATAACGGTGTGCACGAGCACGAAGATGCTTCGGCAGCTTCTGACGAGCTTTGTCAGAAGGCGCGGAGCCAT
AGGTCAGCAAGAGCTTCGCGTCCGCGTCGTGCGCGTACGCGACCTTCACGTCGTCCAACAGTGACGACGTTGGGGTGCTCGATCGCATGGCGTCAATGGC
ATTGACGTCGGCATCAGTCGTGGCGTAGTCAGGTCGGCGTGAGAGCGCGTCGGCCACCACATTGAGTCTTCCGGGTTTGTACTCAACCCGGAAGTTATAC
TCTGCGAAGAATGAGAGCCATCTCGCCATCCGTTGCGAGATGTGCGGCGACTTCACAGCCGTCCGCAGCGACGCGTGGTCCGTATAGACCACGAACGGTT
TGCTTCCGAGTAGATACACTCGGAACTTCGCGAGTGCGTACTTCATGGCAAGGCGTTCCTTGTCATGTACCGGGTAGTTGCGCTCAGCTGGCTTCAGCTG
ACGCGATTGGTAGTAGACCACACGATCACGACCCTCGTGATCGTGCTGCATCAACGCACATCCGATTACAAAATCGGATGCATCGCACACAACGTGGAAT
GGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACTGCATCGAAGGCCTGCTGACACTCAGCAGCCCAATTCCACTCGG
CGTCCTTTTTCAGGAGCTGTGACAGCGGGCGTATCATGCCCGCGTAGTCCTTCACGTACTTGCACAAGTACGTGGCCAAGCCAAGGAACTGCCGCAGTTC
ATTGACATTCGACGGCGTCGGCCACTCATTGATCACTCTGACCTTCTCAGGGTCAGGGCGGACACCGTTCTTCCCAACGAGACACCCGACCACGGGTATC
TCGCTCGCCCCGAAGATGCACTTCTTCAGGTTCGCATAGAGCTTGTGCTTGCGCATGAGCGCAAGCAGCTTCCGGAGATGCACCTTGTGCATCTCGACAA
CGCTCATCCCGTCCGCAGCCCGGCTGTGGACGAACACATCGTCGAAGTAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAACTGCGTCACGCACCTGTT
GAAGGTCGCAGGGGCGTTCTTCAGACCCTGCGGCATCACTAGCCACTCCCAGAGCATGCCGCTCGGCGTGCTCACAGCCGTGAGAGGGATATCGCTCTCA
CGCATGAGGATCTGATAGAACCCATCGCGCAGATCAAGAGCACTGTAGACAGTGCTCCTGGCCATCGAATTGATGATGACATCTTTTCGCGGTATCGGTG
TCTGCGCCGGTATCGTCGCATCGTTCAGCTTGTTGTATGCATGAACGATGCGCCATCCGCCCTGTGGCTTCTTGACACAGAACGTCGGGGCACTGTGCGG
GGACTTCGATTCCCGCACCTGTCCAGCTTTGCGACGACTTTCGAAGAAGTCGTCGATCACTTCGACCTGCTCTCGCGGCAGTGGCCACTGCCGCGTGACA
CAGTACTTCGTGCCCGGCACGAGATCAATCTCGTGTTGGATGCCCTTGTCCTGCGGAAGCTCCACAGGGATCTCTTCCGGAAGCACGTCCGCGTGCTCCC
GTAGAATCTCGTAGAAGGACTCCTTTTCAGCGAGTCCCAGCTCTGCTCCTCAAAGCACTCCTTCTTAGTCTTCGCACTGAGAGTGTAGTGGTGCTCTCCA
TGAAGAACTGCCTCAGTTCTTCATTCTCGCTCTTCGTTCTCACGGCGTCCGAGAGAATGCATATTTGCTCGATGCGTCCATCGTGCAAGTCACGCGCGAA
GCGCTTCCAGCTCACGACTGGAAGCGAAGTCAACTCCGACGCTTGCGTCGGAGGATTAGCGAGAGTCATCTCCCTGTACCGGAACCCGGAACAGGTACGC
GTCAAGACGTTCAACGTTTCGACGTCCGGCTTCTCAGCCCCCGTCTGCCCGGCAGACATTTCTTGTAGCGTCTCGGCCCCAGGCCGAAACTTGCGCAGCG
ACCTTCGCATGCGCCGTCTTCTTGTTTTGCGGAGCCCGGCTCCGCTTGGTTCTTGACCTCGTCCAGGCCCAGCCGTGGACGGGTGTTCTTCTTGTATACC
GCCGGCGGGTATATCCCGCGGACGAGCGACTTCAAGCCCGGCTTGGTCGCCAGGCGCTTCGTCGTGCAGCCCGGCTGCACGACAGCATGCAAGATTTTCC
GGTGCGGGACGTTTGCAACCGTCCGCACCGCCTGCAGCATCGACTCCCGGAGTCGACGGCGTTTCGTCACCTTGGCTCTTATTATTGGCCAAAACTGATC
CAATCAGATTCGCGTCAGCCTCCACGGCTGAGGCGTGTGACTCGCCTGCGTTTTCCGTGCCCCTTGAGGTCGGAGACTCTTCCTGATTCGCTGAAAAGCG
GGTGTCGATCTCCGAGATCAACACATTTTCTCCTTCAACCGTCGGCGGCGACGCCGACGCTTGCTGCTCTTGCGCGCGTGCTCGCGCGCGCTCAGGGCGC
TCCGGGACAGCGGCATTAGGCGCTGTCTCGAGTGGGGAGTCGCGCGCATCTGACGGTGCGTGCGTAGCGGCAACAGGGCCATCGCTCACTGTTCCGCTGT
CGCGACCGAAGCGCACGAGAGTGCGCTTCTCCCAATCGATGACCGGATCATGCCGTGGCTTGCACGGCATGCCCAATACAATGTCAAACTTATCGTCCAG
ATCCAGGACGATAAAGGTCTCGAAAAACTCTTGATCTTCATACGTGAAGCGCACGCGTACCATGCGCTTCTCGGTCTTCACGACGGCACTCGTTGCCAGT
CGTACCTCCAACATACTTCGAGGTATCTTTAAATCATCGAAGTCAAGCCTTGATAGACTTCGCAGTCGAACAAAGTTGTTCGACGCGCCCGAATCAACCA
AAGCACAAAATGAGTTGCTCTCTCTCTCTTCGAAGACACGTTCAAGATGACAAGGTTCGGTTTCTCATCATGCATTTTGCAGTGAGAAGGGTCGTCACTG
AGGGCTGCAGTCCTCAGTGTCGCATGTCCGAGTTGGACATGCGTGACTGCTTCACCAGTAGGGCGCCCCGCGCCTACTGGGTTCCAGCGTTTTTTTTGTC
CGCGACGATGCCCGGCATCGCCGCGTCGACCACCATCTCGGTGCTCGGGTGCCGTGCACTCTCGGGCAAAGTGACCGATCCTTCCGCAATGGAAGCATCG
TACATTACTTCCTTGTTGCTGTTGATAACCAACAGCCGTTGCATTCGAGAGGTCCATTGGTTCCGGACCTCCCACTATCGCGACCGGAGGCGGTTGCAGC
CTCGGCGCATTCGCATGCAGTTTAGTCTGCCTCAGACTAAACTCCTCCTGCATTGCAAGAGTAATCGCAGCTTCGAGAGTGCCTGGGTACTCACGGAAGC
GATAGGACTTTACAGGCCCATCTCTCAGACCCTTCATGAACGTGACGACCTTGGTCGCCTCGTCTATCGGGTTGGTCACGATGTTCGAGACCAAGTACCG
AGCTCTCTGCACGTAAGCATGGGCATCATGCTTGCCCTGCTGCAGGTCGAGGAACTCCGCCCTCGACCGGAACTCGTTTTGCGTTGGCTCAAACGCTTGT
CTGAGCTCCTCCTTGAAACCGTCGTACGTGCTAAAGCACGTAGGATCAGAGAGTCGGCGTCCATACGCCCAACTTCTTGCACGTCCGCCAAGACATGACA
TGGCGAACGCGACCTTCGACAACGGGTCGACGATGCGTCGAGCCGCAATGGCAGTGTCGAGTTCGACAAGCCAACGGAGGAGAGGCTCGCCCTCTCTTCC
AACGTAATTGCTCACGCTGAGCTTCAGCGATTGCGCGCGCGGTGTCGTCCCCGACGACACCGTGGTAGACGAAGCAGCATCTCGCTGCTCCCTCATGATG
AACCCCAGAGCAACACCATGTTGCTCTGTCGGCGATAGCGTACGCAGCATCGCAGCTACTGCCGCCTCCCCAATGATTGTTGACAGTCGTTGGAGTGCCT
CCCACTCTGGATCCGACAGGTGGAGGCAGTCAGCGCGTGCAACATGAGTTGCAGGCGAAGTGGATCTTTCCATGGGCACCTCCGCGCTCATGAAAAGGTT
CTCGGCTCCTCGTTCGTACAGCTCCGTACGAACGTTCAGGTAGTCGGTCGTTGCATGGACTACTAAGTGCTACCAGGTGTAATGGGCCTACTTTGGCTCA
CTACTACGGCTTACACGTATGCGCACGTGTATGAGGAAGCGTAGGTTTCTTTTACTTGAATTAAGTATACTCGAGATCCACGAGTTTACTTTCAACAAGA
TAAAGACTCCAAGTAGCGGGTTTTGGTAAAAGATGAGAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATGTAATATTCTAAGTTAGGAATCT
GCCAACGGCTGGTTGGCAGGATTCTGCTAACATGCAAGTCACTCATTGGCTAAAAGATGCTGCTTTCAGCCAATAGGAATCCTAAATGTGCATGGACCAC
CCGTCGTGGTGGTCGTAAATGTATGTAGCCATTGGTGTACCTTACACCAAGGTCGAGGAAGTG