Description :
From Genome Similarity Track
Location :
Scaffold_27:15106- 16954
Transcript NameFunction/comments
Phypl_g1102conserved hypothetical protein

Sequence
1848 bases(100 bases per row)
TCCCGTACAAGTACGAGACGGACATGGTGGCCATGCAGGTGCGCCACCTCGTGAGCGACTCGAAGTGCAACGACTCGGACTacacggccacgacgctTGT
TGACGGCAAGGTGCTCCCCGTCACGGAGCCCATGGAGGCCGAGCAGCCCATGGCCGACGACCGAGTTTTCTTCATGCTCAACGGCGCCAACGACGGCGTC
TACGTGTCCTGGAACGGCCAGTTCGAGTGCGTGGGGCAGGCGGCCGAGgtagctgcagcgtggcTAGGAGCTGACCGCGACGTGATGGTGAACGGCGTGC
GTCTGTACAGTCAGATGGGCTGGCCCGTTCGCAACgcgaaggagctgcgcgatACGAAGAACATcgttcacgtgctgctggacttccaGTTGTGGCAGTG
GCCGGGTATCAAGAAGGGATACAAGTACGTGTTGGAAGACGgcgcgacgctgacgacTGTGGGTATGAGCCCGAAAGTGTTCGACGTCAAGTACTTTATA
ACTCAGGAGGAAGCTGATAAGGCCATTGAAGTCGggtcgtcgaagctggacCGATCGAAGGTCGATGGCAACAACTCGTCCAAGGTGGTGTCGAAGTCGC
GCACGAGTCACACGGCCTTCTTGCCCGACAGCTTGTTCACGCGTGATTTCCAGAAGCGTTCGGCCCGTGTGGCACGACTTCCGAGTCCGTCCTATGTGGA
GCGcatgcagctcgtgcgctACGCTGCTGGTGAGTTCTACCGTCAGCACTTCGACACCTTCCACTCGCGTGAGTTCTTGCCAAAGGGCGCTGACGcgttc
gagttcgaggacTACGTGAAGTGGACCAAGTGGGCCGCGGAGAAGCTTCGCGGTCTGGATCAGAGCAAGGTGCCTGAGGAGTTCCGTGAGGGTGGCCCGT
TGTTCCCGAATGCGAATGACCCGAAGATCTTCCCTAGCGCTCTTCTTGAGGCGTTCTACGACTACATGAAGACGACCAACAGGTTCAAGGCTCTATTCGA
CACCGAGTACGATGAGTGGATCCGCACTAACTTGGATCTTGGCGCTGATAACCTCATGAAGGACctgatggaggagaagagGCGACCGTCATACTTGCCA
CGCATCATCCAGACCTGGGAGGATAAGCTGGGccttggcgagctgcgctACACGTTCCCTAAGCACGACACGAACTCCGTTTCTCACTTCTTCCAGTGGG
TTCGCTGGGCCAAGGAGCGTGTGAGCTACCTTGGAGACAAGGTGCCAGCTGCGGCCCGTCCGGATGGAGATTTGTACCCCAGATTCACGGTGGAGTTTca
ggagatgctggtggGCTTCATCCTCGACGACTACACGCAGGGTTTTGTCACGCGCATGGCCAACCCGGAATGGTACGACTGGATGGTGCTCAACCGCGGC
CGCAACCACGTCCTCTTCCAGGTCATGCAGGTGTGGCCGCAGTTTGCAGAGCTAGCGATCCGTACGTGGGAGACGCGCGTCGGCAACGCTCCAGAGCTGC
GTTACAAGCTGCccgagcacgtccagcacttccacccGCAGCGATACGTGACGCTGTTCCTCTACCTGAACAACCAGACCAAGATCGGTGGCGAGACCGT
GTTCCCGTTCTCTCTGGACAGGTACTCGGACGAGACGATCGTGCGCGACGGCATGGACGAGTGCTCCTCGGGTCTGGCCGTGCCTCCTCTCGGTCTGCAC
GCCTCTCTCTTTTACGTCCAGACTCCGGAGGGCATCCCGGACGTCATGAGCCGCCATGGTGGCTGCCCGCCCCACGAGGGTGTCAAGTGGGGCGCCAACT
CGTTCATGTGGGACTCGGACTCCGAGGAAGGCGCCGACCTCTGGACCA