Description :
From Genome Similarity Track
Location :
contig_50:151019- 152886
Transcript NameFunction/comments
g10369.t1hypothetical protein

Sequence
1867 bases(100 bases per row)
CCATATACCACGTAGAGCTACACGTACAGTAGTAGCAAAATCCCACGCCGTATTCGGGCAGTTCGTGGCAGATGCTGGCGAAGACGACGAGGGCGGTCGA
CAGGTCCCCTGTAACAGTCTTGCGCCGAGGAAGGTCTTGCTTGGCGTGTCCGACGTGCGGTCCTTGGGTAGGCAGGTGACGAGGTTGGTGGAGGGGTTGT
TGCTATTGAAAGCAAATTGAGAAGTGATTGAGATTGAGCTGTTTGCTTTTACGGATGTCCTTGAGACCACTAGTGTCCTACCCTAAAGCCTATCCTTCTC
TAATCTCAGCTGCTATCTGTTCTACCAATGATCTTGTCTAAAATATCCACGTAGTTGTAGTTTCATCAAAAATCCAGTTCCCATACTGGATATTATCAAA
TCTTGATGATTTAGACCAATCAAATTAATGATTATCGGACGTATCAGATTCTTGTTCTTATCCTTGAATATCTTGCGCCATTCAGATATTGGTAGACATG
CATACGAAAATTTATTGTTCAACCAGATTGGTTGTAGTTGCGGCAATACCTGCCGCTGACGGCAACTGCGTCACATGACCTCCCTTCAAGAAGACGCCTA
TTTTGAAAATGGCTTCGGTCGCTTCTTGGATTTCCAATAGAGGTCGATGAGCCCAGGAATCTGCTTTAGATTCTCAATGGGTTCCCAGGTTGCATCAGCT
CTGAATTCACCTAGCCACCAAATCTTGTACTGCGGTTTTCCCTTGTACATGCGGTGATCAATCACCGCTTCAACGAGTTGTCCTTCGGTTCCATCGGCTA
ACACGACTTTGTTCACCTGCTGCCTTCGCTTTGGGTCCTTGCGATACGGTTTCAGCAATGATGTGTGGAACACAGGATGCAACTTTAATCCCTTCGATAA
TCCCAACTCATAGGAATCTTTTGAGATCTTCTTTATCACTGGAAAAGGTCCAATGTATCGTGGAGCGAGTTTCTTCGACTGGGCATACCCCTTGTGACGG
ATATCCAAATTCTTTCCGTCTAAAAGCACCATGTCGTTGACTTCGAAGTTCTGGACAAGTCTATTCTTGTCGTAATAATACTTCATACGCTCCTGCGCCT
CGCTCATACGGTCTTGTGCGACCTTGAGTAGAGTCTCTTGCTGAAGTAAAAACTCTTGCGCTGTTTTCTCCAATTTCTTAAACTCCGGATCTGATGCCAC
ATCGTCTGGCATGTAGGGGACATATCCTAGATCCGCTTCGAACGGCGACATTCGAATCGTGGAGTGTACACGTCGGTTGTAGGCAATTTCTGCCAAATGG
AGATATTCATCCCAGTCATTTTGAGCTGGGTTGACGACACCTCGAAGATAATCTCCGATAAATCGATTTGTCCGTTCCGTTTGTCCATCTGTTTGGGGTC
GGAAAGCCGATGACAAGTTGTGCTGCGTACCAAGCGCACTCACAATACTCTGCCAAAGTTTGGACGTAAACTTGGTGTCTCGATCGGATATAATGGTTTT
GGGTAAACCGTGATCCTTTACATAATTCTTCATGAACACGTTAGCGATATCTGTGGTGTTGTCCGTTGTCTTCGTCGCAACGAACTTCGCTCGCTTTGTC
AGCCGGTCAACGATTACCATAATCGCATCGCAACCTTTGGTGCTGACAGGCAGTGACACTACAAAATCCATTGAGATGTCTGTCCACCTACCCGAAGGTA
TGTCTAGTGGTTGAAGTAGTCCCGGCGGCTTGGTTTGTCTCGCCTTGTTGCGCTGACACATTTCACATGTGTTGACATAGCGCTGGATGTACTTCATCAT
CTTCGGCCAGTAGTATTTCTCGCGTACTGCCAAATAGGTCTTATAAAACCCTGGGTGTCCTGCTGCT