Description :
From Genome Similarity Track
Location :
Scaffold_3823:1510- 2611
Sequence
1101 bases(100 bases per row)
GCTGGCTGTTTCTCGCCCTTTTTATCCGTGGCTAAAGCCTCCCAGGTCTTATATTCCCGCGAACTTGTGAGATGTTGTCCATACTGTTTGTATTACAAAA
TCCTGTTAGATTCTATAGTTGCTGAAAAGAAGTACTATGAGTTCTCACAGTGCATGTGATGTAACAGAGCCGGGCCGCAGATCGTTGACCACATCGAGGT
CTGGTGCGTCAAGAAAACAAACAAACTTGGTGACTTGGGCGAGATGGGGATCGCAAGAGAGATACAATATCATGGAAGACGCCACCACTCGCCATCCATC
GCTTCCGAAAATGGGATACCAGATATAGAGAGACCGCCGGCTCATGGCGTCCTGGCCCAGAGCATCAATCAAAGTCCAGAGCCTAGGAGAACTTTGCAAG
ATAAAAAAAGTGTAGACTGGCAAACCTCGTGGCGGTACAGGAGCGGTATTATTTTAATAAACCAAGAGCAAAGAAGCTGGTGTTGGATGAACGCGTGCGG
CACCTCGCAACAGGGATCTCACGCGAGCTTCTTGCAACAGCCCCAATCAGTTTTCAGGTTTGTTGATGGCCATCTGGTGGGCAACTGTGGCTCTTTTCTG
TACATCGGGGGATGCGTGAGACCTGTTTTACAAGCAGACCACCACAAGTCGCTGGTGCATACAAAAAGCAAGACAAACCAAAATAGTAAGATAAAAATAC
TATGTTTAAAACACCTTTCTCTCCAACATTGACATCCGTTTGCGCGATGTGGGTGGAAGACGCCATCTCTTTTCTATTACAAAAGTGCAGGTGGACCCTT
GAACGAGCGAACGGTTGATTGACGGATGTCGCCGTGCAGAGCAAATCGCTATTCCAGGTCGCTCGCCTGTTTGTTAGCGTCCAACCAGCCACTCAGAGGC
GTCAAATTCGCCACTTGCGCGTCAGCTGCCCAGCAATCGTGATGCAAGCAAGCGAGCGAGGGAAATGGAACTTTGTTGCTTGCTTGTTTGTGTGTTGTTT
GACTGGATGTGTGTGTCGTTATTCAATGCGATGCGCAAACGAAGACAGAGAACCCATCCTCCGTTGCTGGTCTGATCTGTGAACGAACAAGAATGAAACT
C