Description :
From Genome Similarity Track
Location :
Scaffold_1886:151- 2323
Sequence
2172 bases(100 bases per row)
GGATCCTTGTTTGCACTACTTAGACATCGAGAGAATGATGCAGAGCACAACCCCATTAGCGCACGGTTCCTCCACTTTGGGCAGCAAGTGCGTCAACACA
ACACGGAGACTCCAGTAGATTTGGTCTTCCGTCTGCATGATAACTCCTCGCGACCGAGGACGCATAACCGCCCCACTGTGTCTGAAGTGGCTGCGACTCT
CATTGAGGATGGCAACCTGGCTCAGCCTCGGGATCTACTGCTCTTTACACGCGATCAAAGGCTGCTACGTTTGTACGAGACTCACGCCGATTACGATCCA
CTCCAATACCCGCTTCTCCTTCCATATGGAGAGAAGGGCTGGACCTACACAGACGAGTTCGCGAATGGTGCTGAGTATCGAAACAAGAAGGCGATGTCGC
TTCGTGAACACGTCGCGTTCCGCCTTCATCAGAAAGTGGATGACCAGTCCGCTCTCCACCAAGGCGGGCGTCTATTTCAACAGTGGTGTGTAGATCATCG
TGCAAAATGTGAGCAAGAACAGCTTCGCTGGGTGGCCGACAATCAGAAAACACTTCGCGCCGATCAATACAGGGGTGTTCAAGACGCTTTGCTCAATGAG
GATACTTTGGCTCTGGCAGAAGGAGAAGTGCTGCTGTCGGAATATGACCGGTTTCAGAACAGATTGGTGCACCCGGACCGGGACGGAGGCAGCAGAGGAC
GACCTACCCACTTTCTTAATCAGGTTGGCAAGCGTATCATACTACCAGCTTCGCACCTGGGTAGCCCGCGGTCCATGTACAAGTCGTATCAAGATTCGAT
GGCAATTGTTCGGGAGTATGGACGGCCCGACGTCTTCCTGACGGAAACGTGCAACCCTAAGTGGGACGAGATTCTTGAAGCGATACCTTCCGATATCCAG
ACAGCTCAAGATCGACCAGACATCGTGGCTCGCGTGTGGCAGCAGAAACTACAAGCGACGCTTGACGATTTAAACCAAGGCGTCCTGGGGCGAGTGCGCG
CGCGGATTTACGTTGTCGAGTTTCAAAAACGAGGGCTCCCCCACGCTCACGTATTGATTATTCTGGCTGACGAAGACAAAGGTACGACCACCCGTGGAGG
TTCATTGGGCTCCACCCGGTAATTGAGGAGGCGATCCTTCAACTCATATCGGTGGAGCCGTGAGCGCTGTCGCGACGAGAGCCAGTCGGACTTCGCGCTC
GTTCCTGCCGTAAGGAACTTGACGATAGGTGCGACAGCCTCATCGTCCCGATACGCCACGCGTATCCGATCATATAGATTCGTTGTCACCCGTGTGATGT
GGGCCAACACGTAGTCAGGACGCCGAGAGAGGGCGTCCGCAAGCACGTTGAGCTTGCCCGTCTTGTACTCGACGTGGAAGTTGTACTCCGCGAAGAAGGA
CAGCCATCTCGTCATTCTATGGGAGAGGTGAGGCGAATTGGTCGCCGTCCTCAAGGATGCGTGGTCTGTGTAGATCACGAAGGACCGGGAGCCCAGAAGG
TGAACACTAAACTTCACAAGGGCATATTTTATTGCCGGGGGCTCCTTGTCATGGACAGGGTAGTTCCGTTCGGTGGCTTTGAGCTGCCTGGACTGGAACG
AGATGACTCGTTCATGTCCAGCCGTGTCGGCCTGCAGCAATGCACACCCGATGGCGTAATCGGAGGCATCGCAGACGACGCTAAACGACTTTGGCTCGTC
CGGCAGGGCCAGGACAGGAGCCTCTTGGAAACTGGCCTTGATGCTGTCAAAAGCATCCTTGTGCTCTTGGCCCCAGCGCCAGTCGACATCCTTCTGAAGG
AGACTCGACAAGGGCTTAGCGAAGCCCGCGTACCCTGCGCTGTACTTGTGAAGGTAGTTGGCCAAGCCCAACCACTTTCGAAGATCCTTCTGGGATCGGG
TCGTCGGCCATGCTGCTATGGCCTTGACCTTGTCTGGGTCAGCCCGAACGCCCACGTTGCTTACGAAGCAACCGAGAACTTTGATCTCTGGTGACGCCAA
AATGCACTTGTCGATGTTGGCGTAGAGCTTGTTCTCTCGCATCACGTCCAACACTCGACGGAGGTGTCCTAGATGCACCTCCATGGCCGTCTTGCCGCCC
TCGGCACGGCTATGGACGAATATGTCGTCGAAGTACGTCTGTACGAAGGTACGCAAAGGGCGGAACAATTGC