Description :
From Genome Similarity Track
Location :
Scaffold_84:150994- 152555
Sequence
1561 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAGGGCCTCCATCACAGATGACTGCTGCATCCTTCCGAACCGAACTGAATCTGAGAGTCGTTCATAT
GGGAGAAGTCGTTCCTATCCATGGCAACGAACTTCGGAGGTTCAGGTAGTCTACCCGCGATGGCGTGAATTGACTACAAGTGCTACCAAGTGTGACGGGG
TCACACAGCACCTTGCGCTAGAGGAAGTTATCTTCCGAGAGTATACAAACTCTCAGTGAACGGCAGTTCACAGGTCCCCTCTTTAATTAAAGAGAGCGAA
GTGACCTAAATAAGGTAGATTGTAAACTGAGTATATTTATAGGTAGGTTAAGTTTGTGGTTAATACAAACTATCAGTTACCTATAGAAATGCAATGTCAT
TTAACCAATGGTTGGTTTTGAATGACCTTGGTACCTTGTACCAAATATCCCGGAGTATGACATGTCATACTCCTGAAGTGTGAAGTGTCACACTTCATGT
AACCAGGGTACACTTAGTGCTACGTACCCCGTTACAGCATTCAACATGCTACAACTTTTGCTTGTGGAGAATGAGATTGACCAACCCCGCGTGATATTAA
CGGATCGCGATTTAGCTTGTATGAACGCCCTCGATAGGGTGTTCCATCGAGATACTGAAATGCGGTAATGATATCAAACAAGTTGAAGTGTTCAAACCAC
TTCAACAAAGTTTATAGAAAAAATGAATAGAAAATATCATAAAAATAACAATATAAATTGATTTGAGCTATTGGGTTAAGAGTGTTTGCGGCTAATGTGA
CTCCTCAAACTACTTTTCACTGAAAACGAATTTCGGCACAGATCACACGAGTAGGTTCCCTTCGCGTTCTGTAATTGCTGCCGAACCCCCCGGTGTTGTT
GTCCGACTGGGTTAGATAAGCAAAAGTAGCAATGGTTACGCATTCGATTAAAAGATGCATCAGCGTTACCGCAGTATTGACAGGTAAAACTTGAGGTTAA
AGCAGACATGACAATATCTGGTACCCACGAAACACCTTCAAATTGCAAGTAGCAGTGGACT