Description :
From Genome Similarity Track
Location :
Scaffold_10:15096- 19857
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_10-fgenesh-gene-0.6Flagellar associated protein
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_10-abinit-gene-0.37Phosphomevalonate kinase

Sequence
4761 bases(100 bases per row)
CACCACAGTTTCAACCACCAAAGCTCGCTGAGCTGCTCATTGACAGCTCCACTCGGCCCGCGACGCTGCGCCACAGACATTTGGACGAGACCAAGAAGAT
CGAGCAGCTCATCGGCAACAGCTGCGGCGGGCGGATCAGCTCCGTGTCAACGAACCTGCCGCCTTCGATCCGCAGACGACTCCAGGCTTCCACGAGGGTC
GAGCAGCGTCGCGAGCAGCTCTACGCGGTCTTGCAACAGGAATACCACTCTCTATGTCATCAGCAGTAGCCAGTCAGTCAGCACCTCTCTCGGCCTTCCT
GTCAGGCTTCGTACGACCAAGGTCTGCCGTTAAATTACATCTTTTGTCTCCTCTTCTCTGTTTACATCTCCAGGAGGAACGCATCCTCGGGGAAGCCGTC
AAAGAGATTGCTGTTGATGGCGTCGTCGAAGAGCGAGGAGCTCTCGGAGAACGCGCTCGACTGTGGATCTGGTTCTTGCTGTTGAGGTGGTTGCTGCAGC
TGAGTCTGTTGTTGCTCGGGCATTGTTGTAAACAGAGGCTGAGCTGTGGTAGTTGCTGTGTTCTGGAACTGCATACTCGAGTTCTGTTGAAGTTGTTGCT
GCTGCTGAAGCTGTTGTTGTTGTTGAGGCATACTCATCCCAAACGGAAACGCGTTCATCATCATCTGCTCGGGCATCATCGGGAATGTACTCATCGGGTT
CATCATCGCCGCCGACTGCATGCCTGGCATCGTATCAAAGCCGCCAGTGACGGGGTTGAACTGCGGTTGGCTCGCGAACGCCTGCTGCTGGTTGAACAGC
GTGTTGAACGGGTCCGCTGGCAGCTGGTTCGAGCCCATGCTGCCGCCGTAGCCGTTGAACATTGCCGACGGGTTGTACATGGCACCACCGCCCGCTGCCG
CCATATTCATCGGCATCTGGCTCTGTAATTGCATCTGCATCGCGAGGTACTGCGGGTTCATCATCGCCATGGGGTTCATCATGTAGTTCTGCTGGTTCAT
GAACGCCATCGCTGCTGGATCGCCCGTGTTCATGTATGAATTGGTCGTGAACGATTGCGGACCACTCATCGTGAACGCCTGCGCGGATGCCGCGGTCATC
GAGGTGTCGCTGAAGCCCGTCGAAGTCATCGCCGAACTCTGGTTTGAGCCGTAGAACACACCATTCGTTGTTGTCGGATAGCCTGAGAGGTTATATAGCA
AGCCCGACAAGGTTAGCACCTGCAGATAACAGTGTGCACCATCCACACAGCTGGCGAAATATGCACGAACCGAATTGCTGAGGGTTCGCCATGGGCATGG
GCGGCTCTGGGAAGGATGTCGGCGATGGGATCAGCGCAGCCGCTGTAGGTAGCTGCATGCTGCTGTTGTCTATTGTTGCAGGAGCGACATGCGCAGCTGG
TGTCGCCTTCTGCTTATTCTGCGCAGCTTGCTGTGCAAGCGCGATCGACGCTTTGGACTTTTTCGATGCGGTCTGGGGCACGGCATTCGGCGGCGCCACT
GCCACCGGCGCTTGCTCCTGCTGCGTCTTGGCCTTCTTGACGCGGTCCGAGCTCTCGTCTTCGATCGCGATCTGCTTGTCCGCGAGCGACGCCAGCACCT
CAAGACGCGCGCCGACCTGCTGTCTGTACGTCATGCACTTGCGGATCCAGTCCTTGTGCTCTCTTGCCAGTGTCTTTGGCGCTATACACACACATAAACA
CGTTCATAAGACACCATACGAATAGTTGTCGCATGATACAAACACGTACGCTCTTGTGTGTGCAACACGTTCCAGCCGCGCAGCGTCGCGTCGTTCTTCT
CAAGCATCGCCTGGATCTCGCGCGACGAGACCTTGCGCTCCGCCGACAGAAACTACACATACACATTCATACACACCATGAGTCTATCCATCAATCCATA
TCCACAGTTCCAATAGCTCCAAAAGAGCTATTCAGAAAACAATTCATTACCTGGGCCGCCACGGCCGCGCGCTGCTGCAGCTGCGTCGCACTGTTCGTCG
CTGCAACTGCCATCTGCTGCTGGTTGGAGCTGCTACTGCTATTAATGCTGGTGCTGGTCGCGGAGCGCATCTGCTGCTGCTGCTGCTGCGGAGTGGGGAA
CGCGCCGTTGGCCATCGCGAGACGCGAGTGTTTTCTAATATGAATGCAGAGTTAACACGCCCATTTCTTCATTTTTGAATCGCGGGGCGAAAAAACGCCA
AATTTTAGGTGGTACACGTAGTATTAGGTGTAAATACGCCTCGTTTTACGTGTATCACGTAAAATTAGGGTGTTTAGAGCCGTAAGTAAGGTGGAAAACG
TTATGCTTGCACAAAGTGTTTTGCCTTTCTTGTGCAATTGACAGTCGAAAAATGAAGATGGAGGAGGTCGAGAATGGGAGCGCGGGCGTGTGCGTGTCGG
CGCCCGGCAAGGTGCTGATCACGGGCGGGTACCTGGTGCTGGACCCCAAGTATGCGGGCCTCGTGCTCGCGAGCACCGCGCGGTTCTACGCGCGCGCGTC
TCCAAAAGCCCAGGTGTGTGTGTGTGTGTCATCCGCTCCATTGCGAAAACCAATCTTTGGCCATCTCACCATTCCTGTTTATGCTGGGCGTGTCCAGAAG
GCATACAATGGAGAAGATGCAGCGGATACAATCCGCGTGGACATTGAGAGTCCGCAGTTCAACCAAGTGGTCCGTGGCGTGCTGCGTCGCGGTGCTGGAG
ATGCGTACCAGTTCCTCGTGAGGTGAGCAAGCAGCATGCTTGACGTCCAGATCACCATAATCTTTGCATTGATCTGACAGTTCATGTGTATGCATATGTC
CACAGTGATGGCTCGGACCGCAACGCGTACATTGAGGAGACGCTGCTGTGCGCGATCAACGGCATCGAGGGCGTCGCGCCGGCCAGCGTCGCTCGCAAAG
CCCAGGAGCTACGAGGAGCGCAGGAGCAGCTCCGCGTGCTGCTTCAAGCAGATAACGACTTCTACTCGCAAGTGAAAAGAGTGAGTAAGCTGTTGTACGA
GTTGTGTTTGTGTGATTGGTAACGCTAGAGCTTAAGTGTGCGTATCTGTTCTGCTTTGTGGTAGTTTCAGAGCTCCAGCAATAGTCTGCACCGACGCAAT
ATCGCAGCGCTCCAGAAATGTCTTCCTCCATACATGGAAGGTACGCTGACTGGGGATATGTTTGCTACATGGCGTGTGTTTAACGCTCACTGTGCCCATA
TAGAGAAGCCAAATGGGGAGCGAGTCGCGATGAAGACTGGCATGGGCAGCTCGGCGGCGCTCGTGACGTCCTTCGTTGGCGCACTCGTGTGTTTCTTTCT
ACCCGATAATCGCTTTGAAGAGCGCGACGCCGACCTCGAGCTCATTCACAACCTCGCGCAGCTGAGTCACTGCTTTGTGCAGCGCAAGGTGCGATGATTC
CCCATTTGTTTCCTACGTTTCCCCCACAATGTGAGACTCGAAACTAATCTCACCACTCTTCTGTTGTTGTTTTTTTTGCAGATCGGCAGTGGCTTTGACG
TGTCGACTGCGTGCTTTGGTTCGCAGCGGTACACACGCTTCCCAGCATCAATTCTGGGCGCGTTCACGACCCCAGAGGCGCTGCAGCCAGCGGCTCTTCA
ACGAGCTCTGCTCGACCGCAGCGCGTGGGATGTGGCAAATCGCGTTGTACGTCAACCTGATCTGATACGTTCAATGTTTGTTGCGAAGCGCCTAACTCTG
ATGTACGATTCATGCAGAAACGGTTTAAGCTGCCACTAAGTCTCTGCCTATTCATGGGGGACGTGTCTGCTGGCTCGTCGACCGTGTCAATGGTTCGCCA
GGTACGCTGTTGCTTCAGTTTAGCCAGTGGCTGATGAGATTATTTCAGTACCAATCCCCCAGCAGCATTGACGATGATAACATTTGTTACCATTCGTGCT
CACAGGTGCTGAGTTGGCAGAAAGCCCAGTCAGCAGAAGCAGAGCGTATCACCTCACGTCTGAATCTCCGCAATTCCCACGTTGAAGCTGGTTTCACCAA
GCTGTTGGCGCTGTTTGAGTCGCCTCAACACGACACATCCAGTTTCGAGAAAGCCCGGAGGGAGATGGCGCAATGCACTTTCGACCAGGTAAGCGTTGCT
ATTGCGTGAATGCAAAATGGTCGGTACTGAAAATAAGACTCGCTAACCTGGTATGTTGTTTGTCTCAATGCAGTGGCAAAGGGTCGACCCAGTGCTCGGA
CGTATCCTGAGCACCATTCGGGAAGAGTTCTTTGCTGTGCGCACCTTGCTGCGGTAAGTTGGTGACTCTGAATCACATTGTTAATGTTCTTGTTCTGGAT
ACTTAACTTGACGTGTTGTGGGACACAGTGAAATGGGGGACCTCGCGGGTGTTCCGGTCGAACCTGCTGAGCAGACGGCGTTGGTGGACGCGACCATGGC
GATCCCTGGCGTGCTCATCGCAGGCGTGCCAGGAGGTGCGTGCATTATCATGGGTATCTAGGGATGTTTTGGGGCTGCACCTGATAACTAGACGCTGTTG
TTGGTATACTGTGTGTAGCTGGTGGATTCGATGCAGTCTTTGTTGTGGCGCTGGACGAGAGTGTGCTGAACCGTGTCGAAGAGCTCTGGGTGCAGTGGCC
ACAAACCCACCCGACATCCATGTACGTGGTTTTGTATCCATGTGTTTGTTGCGCTGATGGTTGGATGATGATACTAATGCTGTGCTTATGCGTTTATAGC
ATATGCCCCCTGCTGTGTGATGCAGATTCAGGACGTGGGTTGCGGCTGGAGAAATAGAGCT