Description :
From Genome Similarity Track
Location :
Scaffold_11:150919- 152227
Transcript NameFunction/comments
Phyin_T30-4PITG_07371Taurine dioxygenase%2C putative

Sequence
1308 bases(100 bases per row)
TTGAGGTCACTCACTTTTCAACTCGCACTCAAGCAAACACCATGGCCCCCAAAAACAACGCTCCGACATCTTCAGGCTCCACGTCAGTGGCGTCCTCGCC
CGCTCCCGTCAAGAACGCATTGAATCTTGAGGTTGAGCACGCTGTATTCACACATCCCGAATTATTCGGCGAGTTCCCCACCACGACTTATGACCCGATT
CCAGAGTTGCCGTACGAGAACCGAGCGCTCAAGGCCGACCCCTCCTTTAAGAATCGGCTCGCCGACGCGACCGTGACGCACCTAGAACCGAAGATCGGCA
CAGAGATCTTGAATCTGCAGTTGCACGAACTGACGGACTCGCAGAAGGATGAGCTAGCGTTGCTGGTGGCCCAGCGTGGAGTGGTGTTCTTCCGCGACCA
AAAGATCTCAATTGAGGATCAGTTGGCTCTGGGTCGTTACTATGGCCCTTTGCACGTGTACCAAACAGTGGCACACGCTAAGGGTACCCCCCAAGTGCAC
GTTGTTGAAAATTTGCTTGAAGATAGCGAGAAGCGCATCAAGACTCAAGCCCTGGAACCTGTAAACCTGTGGCACAGTGACGTGTCTTACGAGCGTCAGG
TGAGAAGCTGTGGGTGTGTCATGTGAGTTTGTCAATGGATGCTAATGTTTATCGTGATAGCCACCGTCATACACGAGTTTCAAGGTCTTGACTACCCCAC
CCACAGGTGGTGACACCTTGTGGGCCTCTGCGTACGAGGCGTATGATCGACTCACACCGCAATTCAAAAAGTTCGCGGAGGGTCTCACTGCCATTCACAG
CAGCAAGGCATGAACAAAAACATAATTCTGCTGATGCATCTTCTGAGTAAGCTCTCACCATGTCACCTATGATGATTGCAGCGTCAAGCCGAGAGCGCTA
TTGCCAATGGGAAGACCCTTCGCCGTCCCATCGTGGAGTTCGAGCACCCTGTTGTTCGTACCCACCCGGTGACTGGCCGCAAAGCACTATACGTGAATGC
CCAGTTTACCACTCGAATCAACAATTTGTCGGCAGCCGAGTCCGGTGCGTTTTTTTGTGTCAAGTTTGAACTTTGATATCTGCGGACAGAATGTAACCTT
GTCGAATTTGCTGCCCAGCCTCTATCTTGCGTTTCCTGCATCAGCACATTGCGCAGGGACACGAGTTCCAGGTTCGTTACCGCTGGACAAAGGATGCGGT
AGCGATTTGGGACAACCGCGCCACGGTTCACTACGCCACGTATGACTATTTACCCGGCAATCGCCATGCTGTTCGTGTGACACCTCATGGCGAGACCCCG
TATTTTGA