Description :
From Genome Similarity Track
Location :
Scaffold_42:1509- 3329
Transcript NameFunction/comments
Phymu_g2337hypothetical protein
Phymu_g2338hypothetical protein PHYSODRAFT_506674

Sequence
1820 bases(100 bases per row)
CAGTCCGGATGTCGCTACGTGCGCGTGCTCCAGCCGAGACCGAGGCAGGAACTCGCGTCGACCGGCTCTGGCGACTTTCTTTCTCGTGGTGTGTTGAGCC
GACAAGACTCAGCACCGCCTCACGACCGCCACTCGAGTCGACGACGTAACGTGCGTTTGGTAGGGCTTCCTCCATCTGTTTCAGCAAAATGAGTCAACAA
AGGATTATCTTTTCGAGTCGATGAGTGTTTTATTGCCCGAACGAAAAAGACCTTCGCGCCTTTGCTGCGCCTTGCCAAGTTGCCATAGAGCAGTGTGTTT
CGGCACCTGCACCTCCCTCCTGCGTGGACTTGCTTGGGCAAATGTACCGCATGATATGAAGGCTGCAAATCCTCCCCCGTAACACAGAACCAAGCTCCAT
GGCGGGCGGGAATCAAGCAGCGGCATTCAAGTTCAagaattttttttttcgaaTCGTAAAGCACCACGCGAAATACGGTAAGCCCATGGCCACCAACatg
cacgtacatgtacatcgtGCTGGACTCGTGCCATCTCTGCTGGCACGTTACACAAATCTTAGGCAGACAGAGACAACTACAGGTACAGTAACTTCCTTTT
TCATCTACATCCGATCGACCGGAGCTCAGCACAGCGCCGATTGCAATCCGGTGGCGTCAGGTGCTTTCCCAACTGCTAGACGGGCCAAAGGACATCACGG
CATCGCCTTGAGGTGAGTCAGAGCAAGCTTTTGGCCGTCAACGGCGCGCGCAGATGGCgcaacctgctgcttgccCCCGGGATCTGAATGGGTCCGTCCA
TCCGCAGTTTTTGTTCCGAGTTTCTCGCCTGCAATTCGGTCACAACTCAATCCGCTCCGAGATCGACAAGTCTCGCCCTCCCACAGTTGCATCGCACTGT
ACACCCTAAAGAGACCAGCATGTTCCAGCTGACAGACTCGTTGCTGCGTGGGGTCATGCACCACCGCGCTCAGTTCCCTTTGGAGTTGTGTCACCCCCCG
GCTTTcgagcccaagaagctctcgctGGCCTTCCCGACCCCGGAGTCGGACACCACCAGCGTAGCTTCCACTACGCCCAGTGACggctcctccgtctcca
cgcCTGTGTTGCGCGAACGGATGAGCCTTAGCTTCATCACTAACCCGGACCCGGTGGTCGACACGCACCAGCAAGCACCGGCGCTCGGGCTCGCGCACGC
GGGCGTCAtctgctccaagaagaactgtTACCGCTCGGCCAACAGCCTCTTCGGCGCCTTCTGCGAGTTCCACAAGCCCAGTCGGCTCTGCAAAGTGCCC
GAGTGCCGGAAGTGCGCCAAGACGGGCGGCTTCTGCATCTCGCACGGCGGTGGTCGTCGGTGCCGGCACGACGGCTGCGTCAAGAGCGCCAAGGAGGGGG
GATACTGTATCGCCCACGGGGGTGGCAAGCGATGCCGTGAAGAAAACTGCTCCAAGTCCGCACTGGCCGGTGGCCTCTGCTCCGCTCACGGAGGAGGCAA
GCGCTGCAGTGCGCCAAACTGCTCCAAGACGGCGCTCAAGGGCGGTCTCTGTATCGCACACGGCGGTGGCAGGAGATGTGAAGTCTCTGGGTGCACCAAG
AGCGCTGTAGGTGGACATCTCTGTGTCTCACATGGGGGCGGTCGCCGGTGCCGGGAATCCGGCTGCAACAAGGGCGCAGTGCGTCGAGGCGTGTGCATCC
GCCACGGAGCACGGCAAGACTAAGATATTGCCACTAGTTAGTTATAAGGAGGCCCTAAGAAAGCGCTATCCCTCATGTAAATGCACCTGTAAAAGTCGCC
ACACCATTCTCTTTCTTGCA