Description :
From Genome Similarity Track
Location :
Scaffold_1569:1509- 3078
Sequence
1569 bases(100 bases per row)
GACCGTGCAGTTGAGCCAATCGATGTCCGGATGATGTCACGCGAGCCACAACATCCCAAAAATGCAGTCGAACTAGCCGCTGAGGTCGATTACCAGGAAC
TCGTCACTGCTCGCGATGCCGTCGAGCGCGTACGGCACAACGACCGAGCGCTGCTGAAGCGCGTGGAGCTTGCCGTCGGCGTAGTTGACGGCCATCTCAC
CAGGAAACTCGCGGGCGCGCAGCCGCAAGGGGAGAACCTTTGAGCTTCCGGCGCGAACGAAGTTATTCGTTGCGCCTGAGTCCAGCATGACGCGAAGCGA
ATGCGTCGCGCCATCATCGCGCACGCTGAATACGATCAGGCGCTTGTCGTTGTTGGACGTGGCGTTATTGAGCTGCGTGTGGAGCACATTGGAGCTGGGA
GAGTGTGCCACCAACGGGGACACATTTCTACCAATTCGCCCAGTTGGCCGCCCCGCGCCACTGGTTGTCTTCGTTTTTTAGCTGTGCAGAGAGGACGACG
TCGTCAGACTCTACGGCATCGAGCGTCGGAACAGACACACCGCAGTCAACCGCGCGGTGACCGGACTTGCGCCATCGAAAACACCACTGGCTTCGGCGAC
GCGGAGCGTGACAGCCCTACACTTGCAGCGTGTCGAGGCGCGGTGCGCTCAATCGCGTCGATTTCCATGGGATCGAGCTCGCTGGCGGTGCGATGGAACG
ATGGTCGGAATATTTGAGACACCATGGCACTGAAGTCTTCGCGAAGCGCGACGGCGAAAGTGAAAGCGTCTTCGAGCGACGCGGGTGGCTTTCGCGCCAG
GTAAATAATGTTGGTGACTACAATTCACTCTCGACACGAAGACATGGACTTGCGTCACCGTGTCAATGGGGTTATTGACAATGCACGACGACTGGTGTCG
TGCGCGCTGGGTGTGGTCAAGCATCGACAAGCGGCCTTGGTTGAGTGCGAGGAACGACGAGCGAAGCTGGCTATCATCTTGTGGTGACTTGAACACGAGC
CGCAAGTCGTTCTTGAGCGAGTTCCTATCCGGGAAAAACAGATTCACGACGAGCGTGCCATTCCTTCGCCTTGCAGGGGAGCTTCGACAGGAGCAAGTGG
GTGCGGGCCAACTCGGTCGTCGACTGGCGGGCTCGAACGGCGATGTCCACTTCACAGAGCCAGCGGTTGAGCACGAGACGCTTTGCGCCTTCGCCACTAT
AGCTGGAGACGTCGAGCTTCACGATCTCGGTCTTCGATGACGACGAGGGAGTTGAGAATCGCCGAACCAGCTTGGCGAACTCGTGCGTCACAAACTCTTG
AACAGCGTTGCACTTTTGCGCGTGCGACGCCGCTGCTAGCATGGCAGTGGCGGTGGTGATATGGGATATGCTTGCGAGACGGCATAGCACGTTTACTCGA
ATGCCGTCAGGTAGTCAAAGTCGCTGTGGCTTAGGGACGTGCCGTCGGCAACTTCGATCGGCGGGGCGCTCATAGTAGATCGTAGGACGGACTACGAAGT
GCTACCAGGTGTAACGGAGCGGGAGCTCAGTTACCATGCGTACACGTTGGTCTTATGAGGAAGCGTAAG