Description :
From Genome Similarity Track
Location :
Scaffold_15:150871- 153006
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_05178conserved unknown protein
Sappa_CBS223.65SPRG_05179unknown

Sequence
2135 bases(100 bases per row)
CGCCGTACGTTTTTGGAGCGGCCGTGAAAGTACTGCGGGTAGCACTGCTTGATCAAGTGAAAGTGCGGCTGCACCTCGTAGAGGATGCCGTCGACGTGGT
TCTCGCGACGCCACTGCAGCGTCGCCTCGTAGCGCGCGCGGCCTTTGACTTCGTCGCCCTTCTCGGCCGCCACGAAGCGGGGCGAGAACGCCAGCTCTGG
AATCACGTCCGGCCGCACGGGCGCCGACACGACGACCTCGTCTGCCTCGTCCTCGGCTTCGGGGCGCTCGTCCTCGACCTCGGGGCGCTCTTCGTCCGGC
GACAAGAGGTCCACCGACGCGACGCGGAGGACGACGTTGTAGAGACTCGCGGTGGGGGATGGCGGCGATTCGCGGGCCGCCGAGGCTTGGAGCACCGACG
ACAGCTGCGCGTAATCGAGGTACGCGACGCCGAGGACCGAGAGGGCGAGGAGCACCCCGAGGGTCGCCGTGACCTTCATGACGCCCTGGAATGGCGGCGA
AAAGGCCAGCGCAATGCCGCAGCTCACGAGGTAGAGCGCGCCAAACGTGGTCGACGTCGTCAAGAGACTCGGCACCGGCGGCCGCTCGGGCGCGAGGGTC
GCCGACGGCACGCGTGACACGACGCGCGTCACGTGCGCAGCCACTACGCACACGACGTGGAGCCAAACAGCGAGACGAACGACATACCGGCGATGGACGT
GCGGGCACCCTTGAGGACGCACTCGAGGCTGCCGCGGCCCGACGCGTCGACGGCCGCGATGATCGGCGCCAGCTGCGCGTGCGGCAAGACGACGACGTCT
TGGTTGTTCATGATAAAGTAGCACGCTTCCTTGACCTTGAGGCCGAGCGGAATCGGCCCGAGGAGGATGTCCTTCTCGAGCTCGAGCTTGCGCGTGATGA
GGCGCTCGCGCCCCGCCGCCGTCGACATGGAGAGTCCAAGTACGATTGGCTGCATGTCCTAGTGGAGCATCAGGAGATGATGCATCGAAATGCAGTGGAA
CGTACCCGGGATGGGGACGGTGGGAGGCTGCCGCTGGGGGCGGCCACCGCGGCCGGCGTCGGCTGGCGACCATCGGGAAGCTCCGGGGATGTGGGCACGC
CGACTGCGATCTTGGTGTACATGTCGAGCATCTCGGCAGTCCATTCCGTCGGGAACGCTTTCTTCTTGCCAATCTCGAGCGCTGCGTTCACGGACGTGGC
CCAGTACTTGGCCGAGTCGGCCGACTCGACGCGCAGGAACCACGTGAGCGTGTGTTGCTTGGAGAAGATGCCCACAAAGTGCGAGTCGACGCCGGCCTCG
ATGGTTCCGTACGGCGCCTCTTCCTCCGGCACGACCTTGGCGTACCCGACGTCCTTGAGCGGCAGCTGGCCGCGCTCCGTGCCAAACACCTCTTGTTCGT
CGCCCTTGCGGTAGTAGTGGAGCCCACGTACACTCAAAATGAAGAGGCGGCGCGCAAACCCGGCGCGAACTGCGCCTTCGCGCCGCTTGTCGACGAGGCC
GGACGCGAGGATGCCGAGGAAGCGGCCCTCGAGCATGCCTGGCAGCGCGCCCCGGAAGCTCGAGTTGCTCCGGAGGACCGAGGACGACGCCACGGACGAA
GACGACGAGTTCTGGCGCTGGAGGCGCGGGCTGCCGCTGGGCTCGCTCGCAGTTCGGCGCATGCTCTCGCTCATGGCACGTTGCAAACTGGATGACGGAG
ACAAAAAACGCACCATGATCGCATTTAACGCGTTATTCGACGGCGTGCGGCCTCTACCAGCAGGCCGCGGCCGCGCACACCAGGCGACCGTCCATCAAAG
GCAGCACCTCCACAGTCTGTGCGTTGCTTTGGCAGCGACTCGGTTCCTTCCCATGCTTTCGCTCGCTTCTCACGACGCCGATCAAAGGCGGTCGCGTGAG
TAAAACCTGTTTGACCGCATTTTGCGTTCTATTTCAGGTGCTCTTGCGTTTTGTATGGAGAGAGCGACGACGAGAAAAGACGTAGGTAGCATTGCGCGCT
TCGACGATGGTGACCGACGGCTTCGAGACGGAGCTTGACGCTGCGGCCAACCGCCGGTACAGCCGCCAGCTGCTCGTGTCGGACTTCGGCGTCCAGCGGC
AGAAGACACTCCTCGAGGCCCGCGTTCTAGGTAGA