Description :
From Genome Similarity Track
Location :
Scaffold_413:15086- 21851
Transcript NameFunction/comments
Phyta_totarag8065hypothetical protein PHYSODRAFT_545950

Sequence
6765 bases(100 bases per row)
TCCATGTCGCGTAGTAGAAACCCGTGTGCGAGTAGTACATCGAGTTCAAACGGAAGAAGTCCATGAACTGGCCCATGCGGTGAGCCTCACGCGCCAGCGA
AGTTTCACCAGCACCGTTGGCCAGCTTACCTTCGAACATCGAAATCTGCGACAGAGCCACATCACGACCCTTACCACACTGCATGAACTCCACGTGAGTC
ACGACACCGCCGCGCAGCGTCGTGTTGAAGCCGGCAAACACATCTTCAGACAGATTGATACCCTTACTGGCCTTCGACACACCACCGCGCGTGATAGCCA
ACACCTTATCGAACACATCCGGGTGGCCGTAGTGCATACGCACGTACAGCGGGTCGGCAAGCACACGTTGAGACAGCGTCACGAACACCAGTTCCTGCCA
CGTCTTGAACTTAGCCAGCGAACTGGCGTTACCCGTGAAAATGTGCTCACGCATACCAATGATCGACACCGGTTTCTTCGACGGGTGCAGGTCAGCCGTG
CACAGTAGCTGCGGCATCTTCAAACACTCCTCGAagtagtgctgctggttcatATCGATAGTCTGCACAAACTCACCGCGCGTGAACGGGGTAGCGTTGT
TCTGGTTCTCAGGCTTACCTTCACCCAGAATCGGATCTCCGGGCAGCGAGTAGCGGTATACTTCCACGATATCATCGGCTTCACTCTTAATCAGCACCGT
GTCGAACGACttctcgccgtcctcgtGCTCCACCGTGTCCACATAAGCCACACGCAGGTTCGGGTACTCGCGCAGCAGATAGTCAATATCAGCGGCCTGG
GTTTTACCCTCCGCGCGGTGCTTTCCGTACACCTGACAAGCGCAAATGTACGAGAATTTCAGCCGAACCATATCCTGCAGCTggttctgcttctgctcgg
cAGACTTCCCAGGACTCGAGCCAATTTCCAGCCAGTGCAGAATCTTGATCGCATCCTCGTACATCATCATGCCCTGCACTGTACGGGCCAGTGTCTGTCC
ACGGTACGACGCCCACAGACGAATTTCTTCGGGGTGGTTCTTCTGAGCCTCCTCGGCGGAGCTCACATCCACACGCTCCAAGAAGTTGTCCCATTCCTCC
TGGTGAATCTTCGTCAGGTACTTCAGGATCGTCAAGTTCTTGCCATcctcttcgacttgctggaagATCGGGTGGTTCACAAGCGGGTCGTTCAGGTCCT
TGAGCGAGAATAGCACCGTCTCAGCGTAGAACGGGGTCACAACCGAAAAGCTGCGCATTTCCTTGATGGAGCGCAGCTGGGGGATGTCCATAACAAGCGA
CTTCATGAAGAATCCGAGACGACGCTGTGCCTCCGTCGTACGTGGCATCGCCTCCGAGCGGTccagagacagcagcagacaggCACGCGTGGCGGCGCCC
ATGGCCGTGTCACTGCAGAACAGGTTCACCAGGCCGCGCGACGCAAACATGTATCCGTTGGCACTCGAGCAGAACTTCGAGTTGGCGAACTTGCGCTGCA
GAGCAGGGTCCAAGCAGAACGACTGAACGCCGTTCAGGAAAGCCTCCATCTTCGAGACAAAGTTGCGGATCACACCCATCGAGTGCACACGCGCGTTCGG
GATGTGCTGAGACTGTACATCAGGGTCTGGCAGGTCAAGAATCTCTTCCAGAAGGTCTACAGCGGCAACGCGCAGGCTTGCCAGCTCACGGACGTTGAAC
GACTTGAGGAAGCCACCGCTAGCAGCGATCTCCTCAATCATGCTGAACCCATCGACCacatcagcgtcgtcgttgccgaACAGAGCGCTAATCACGTACA
TGCTGGCGGTGAAGAACGAGCGGATAGCCGAGAGGCAGTCGTTCTCAACAAGCGTCACGCGGAGCTGAGACTCGCCCTTGCCGTCCTTAGCTGTCTTGAT
CGCCAGACCCATGGCCTCCGTCAGCTTACCAGCCGACAAGAACACGGGCTCGAACACCTCACCGGTGCTGCGGATGTCGTACTGAAGAATAGCAGCCTCC
TTGTCATCAAGCAGATCGCCCTCACGGAACGAGTTGACGATTTCGTtccacaccaccacgaaccGCAGCATCATCTGCGACTCGTAAGCCGCAGCCAAGG
CACTAGCACGGGTTGAGTCCATGCCCCCACTGGCAGTGGCATCGCTCGAACGCGCCAGAAGAGTCACCACCTTCTGGTCGAACAACTGCGGCGCGACGCG
GAAAGCCTTGGTCATTTCCTTGGCCCCACGAATCTCGCCCGTCTTCATGAGAATACCCTGGAATccacccagcagcgcctggaaGATCGTGAAGTAAATC
TGCGTGGCGTAGTTGAAAATGAACACCATCGGCAGCCACAGAGCAATGATAATGCCAATGTTGTGGAACGACACGAGCGAGTTCTGATAGTCCAGCGTCA
TGGCGTAAATACTCAACGACGGCAGAATGAGCGGGCGGACCAGAATAAAGTACGACGTGATGGCCTGGACAATCCACAACAGGATCCAGAACGCGATGTA
CTTGATCTGGAACGAGAACGGCGGCGTCATGTCTTGACCGACGTAGCAGCTCTCTCCTTCACGGACAAATTTGGCCGCGAATGTTCCGCTAATGACCTGG
GGAGCGAAAGCTTGCgtcaacagcaccagcaaccCCGGCAGGATGAAAGCACCGCACAATGGGTACAAattgtccagcagcgtcgtgtccTTTTCTTCGT
TCAGCGGCACGTAAATCATGATGCCGAACAAGACGGCAAAGCCTCCGTTCCAGATGATTCGGGTAGCCAAGGCTGACCCATAGGAAAAAGACCGCGAACT
CGTGGCCGAACTCTCCTTTGACGTCAACAAGTGCCATCCGTGACACACCTCCATCACACACTTGAGGAAAGCCATCAGACTCAAACTGAACGGGATAGCG
ACCACCGCGAGCTTCAAGTCACGGGTCGTGTACGGGTCCACGACGTCTCCAATGCGTCCGAACTGGACCCACCCACTCTTGCCTCCATCAGGCGAAATAG
TGACGGCAAAGGCCAAAACCGTGAGCAGAACCAGGAACATCATGTTGAACTGGAAAATCCGGTAATAGTTGAGGATCATCGTGAAAATGCTGCGGTGCTC
GTAAAACGTCTTGCCGTGGTTCTGGGTCAGCTCCTCCCCCACTTTAGTGACCGGAATGCTGAGACAGTGCTGTTTCCAAAAATACTCGTTGATGTCATCG
TAGTTACGGATTTTGACATGTTCCAGAGGCTTGCCCAGTGCATTGCGGCGCTTCATGTTGCTGGCTTCTCTCCAAATGGGGCGGATCACTTGGTCCAAGT
ACCAGCCTTCCGGTTGCTGTTCGCGGCCTTGTGGGTCCGCGTTCACCATGGTCAACATCTGGTGGAAGAGGTAGCATACACATTCTGGCATATGACGAAT
GTTGGCCGCTTCTCCCCAAATCAGGAAATACAGCATCACGTCCATGTGCAAATTGCCAGAAGACGTAGCATTGGGAATACCATTTCCAGTATACGTCACT
AGATTCGTGTGGATGAATTTGCACCACGACCGATAATTGGTGAAAAGCTTGTCAGCTAATTGGACGAGATGCTGGTCCGCCGAGTCGCTCGGCAAACAAC
GCGCCTTGCCGTTTGCCAAAAGAAGGAGCACGTGTTCGCGCTGGTTGCTCACCGAACCCTCCTGGAACCCGAATTTAGCCTTGAGGAACTCGCAGCAGTA
ATCGATGgccgcctcgtcgtcctgcgTCGCGCCCTTGACGCTCGTGGACGTCACGTCCATCGTGTTGAGGCGCGAGCTGAAGCGCGCCGAGCGCTCCGAC
TTGTTGCGGCGTCGGTCAGCGTCCAGTTCGAAGTAGTTGGAGCTGGCGCGTCGACGTCGGTCCATCTCGCCGTGTCCCGAAGGTCCGCGCTGCGCCATGT
TTTGCTGCGCGTTTATTTTCGGGTCGTTTTGTTTTCGGATCCTGCTTGGCAGcaaatgaagaagaggaagttgtTTGAGGTTGGTCTAAAGCGACAGGGG
GTGgacacgaagacgccgacgacggaTTTGCCTTTTGCCTTTGTCTGTCTGCCTTCCTTCCTCTCTTCGCTGGGGGTTTCCCGTTGTGACGGCTCCGATG
AGCCGATAGCGAAGGCTCGCGTGCGAAAGAGGGAGAATGCAGGTGGATAGGGCAGGGCAAGCTTGACTGGGCTCCAGTATGGAAACGGCCCACGCAAATA
TTCAGCGCGCGCGGCCAGAGACAGGCCGCGGTattttcgaccaatcaaacAGGCGGCCACAAAGCGAGACAAGCCACCACTTTCGGCTTTCCGCCCTGCG
TAGACCGCCATCTGCGCCCCAAGCACCCTGCACTCTGAAAGGATCaggcgggggggggggggggggggggggggggggcagaGGAACAAGTCGACAAACA
AGACCCAGAATGCGCTTGGTTTGCCACCACGTTGGACTGTGTCGAACGGGCCGTGGCTTCAATAATTGCTATGATTGGTCCCTTATTTAGGCGATCTTCT
CCCCCTGATTGGCTCAAAAAATGTTGACGGATTTTTTGAGAAAATTGGGAATTTGATTGATGGCTGCCTGAATATCCTGGAACGGCTCCAGTGGCCAAAT
GGCTTCCTTCCGTCTCTCTAATGTCAAGAGAGTATCAATTACTAGCACCCGAATCTGGCCTGATGGCATCTGCCGCACCAACTCGTTAATTGCCAATTTG
CCGGCTAGCCTCCACTGCTATTCATTCGGCAGCAGATGTTGGACTGCAGCGGCAGACGACATCCCTGTTCGCGATATCGAGGGAGTTTGCGATACGTCGC
TATATTCCTGAGCGATCCGGGCGATCGATCGGGGCTTGGCTCTCGACTCGATTGATTTGCGGGGCTGCCACCGCATGGCAATTGCACTTGGGTTAATTTC
TTGCAGCGTCCCTGGGTGGGTTAGGAAATTTATTGGCAAGAGTGAGCCATGGCACAGCGGCCGCGCCTCAGCTGCACGGTGCAGCCTTGGTCTATCCGTC
GAGATTGGGCGGCGTATGTCCTTGTTACGCATGGGACCAAGAAACGAATGCGGTGGCGCCATGACCTTTCGATGCAGGACGGACATAACTGAACTTGCTG
GAGCGCTGGTGGCCGTCCTCGGACGGACGCCCCGCTGTTACTGTCGGAGCCGAAACCGACTAGAAGTGCATGAAGTGGCTGATGGAAATGGTATTTTGTC
TGCCATGGCAAAATGCGTTGAGCcgggtacatgtacagcgtTGTCCTTCGCCTACAGACAACGCGTGTGACGATctcaagttgaagacaaacccacgtgt
ctcaCGAGCAGGTTAACCACGCCAGTCAATTGACAGGGATCctattgtacatgtacatgtaagttaGACGAATGGCTCAATGTACTACATATATTAACTA
CGCTAGAGTGTCCGTTTTCGCCGAAACAGAGGCCAACCACAGACGCTTCATGCTTGGAGATGTGCTCAACAGCaatggtggtggtgacgatCATGACGAT
CATGAGAAGAAGTTAACATTCAGCTTACCACTAGGTGAAGCGGCTATATTTATCCAACGGCTACGGCGCAGCTTAGGCACGTCGCAGACGTATGGTTGTG
GCTGAAACACCCTGCATTTCAACACGCAAACCGTAAATTTATCTAGTACGCCGCGCTCCAGCGCAGCAAAGGGGTGTGATGGAGACTTGCGGCTTACTTA
TATTGCAGTTGACGCACCCGTCGTAGCTGGACGTAGATAATCGTAGTCGTTAGCACAGCTGGTATTGGTATTATTATAGCTACGTAGATAtccaacagcg
tcagcgatGACTCCATCCTACAGATATTTACCGGGGCGAACATGCCGCGATATTCATTGATTTAATCTAATTTTAAAAATCCCGTTCAATCAGCGATGCA
TGACGTGAGCGAAAACGGCAAATGTTGCAATATCCATTAACGTAATGTATCGGTCTTGTGCAGATATTCGCTGCACCAGTGTTGGCAACGGACGTATAAA
CGTTCTATGCTAAAAACACGTAATAACACCTTCTTGAGTGTACATTCNCAGATTCTCAATTTATAAAAATTAAGTCAACTTTTTACGGGTAATTACGAGT
TCGATCTCGTAAAAACTGTTTATACGCACAGTATAAAACGTATAAACAGTATAAACGTTTAGACGTTTCTAATCGGATTGTCATTACCAGCACCGAAGTT
TTAGAACAATGGATATTAATAAACGTCAACTTCCCATGCCATAACTTCATCGTCACACTATCGTGTCTGTAACTCTGCAATGGTAGTTTACATCTTCCGT
CCTAGTTATTTCTACTGTGGTGCACAACCTTGGGCTACTGTTCATGTATTCATTAGCGTTGCGCTTCTCAACGCCCAATGTTGAAATGTAGCCCATGCAA
CAGCTTTTTTAAAACCGATTTGAAAATCGACTTCTGCCCAGCCTGCTCTTCCCAATTGAGCTACTTTCTCACTCTTCAATCTGCGCGACTCGATCACCAG
TCTACTATGGATACGGGCCCAAGGAAGGGCGACCACCATCCTGTGACATAGTCAAACTCATGGTCACTAtcgtcgctgcagtggctgcagctaCAGTTAG
TTATCAACGAAAGCCTTTCTGATCCAGGATCTCTGTTGAACCCGCACTCGCAGTTCTTGCGGCTCCGTGGTGGGCACCACCACTAACTTCCGGACTACAG
GGGCGCTCATCTAACGTTACCTTTAGATGGGAGTGAAGAAAATGGTAAACCCTGGCCAGCAAGCG