Description :
From Genome Similarity Track
Location :
contig_50:150854- 152725
Transcript NameFunction/comments
g8440.t1hypothetical protein

Sequence
1871 bases(100 bases per row)
TTGTCTAAAATATCCACGTAGTTGTAGTTTCATCAAAAATCCAGTTCCCATACTGGATATTATCAAATCTTGATGATTTAGACCAATCAAATTAATGATT
ATCGGACGTATCAGATTCTTGTTCTTATCCTTGAATATCTTGCGCCATTCAGATATTGGTAGACATGCATACGAAAATTTATTGTTCAACCAGATTGGTT
GTAGTTGCGGCAATACCTGCCGCTGACGGCAACTGCGTCACATGACCTCCCTTCAAGAAGACGCCTATTTTGAAAATGGCTTCGGTCGCTTCTTGGATTT
CCAATAGAGGTCGATGAGCCCAGGAATCTGCTTTAGATTCTCAATGGGTTCCCAGGTTGCATCAGCTCTGAATTCACCTAGCCACCAAATCTTGTACTGC
GGTTTTCCCTTGTACATGCGGTGATCAATCACCGCTTCAACGAGTTGTCCTTCGGTTCCATCGGCTAACACGACTTTGTTCACCTGCTGCCTTCGCTTTG
GGTCCTTGCGATACGGTTTCAGCAATGATGTGTGGAACACAGGATGCAACTTTAATCCCTTCGATAATCCCAACTCATAGGAATCTTTTGAGATCTTCTT
TATCACTGGAAAAGGTCCAATGTATCGTGGAGCGAGTTTCTTCGACTGGGCATACCCCTTGTGACGGATATCCAAATTCTTTCCGTCTAAAAGCACCATG
TCGTTGACTTCGAAGTTCTGGACAAGTCTATTCTTGTCGTAATAATACTTCATACGCTCCTGCGCCTCGCTCATACGGTCTTGTGCGACCTTGAGTAGAG
TCTCTTGCTGAAGTAAAAACTCTTGCGCTGTTTTCTCCAATTTCTTAAACTCCGGATCTGATGCCACATCGTCTGGCATGTAGGGGACATATCCTAGATC
CGCTTCGAACGGCGACATTCGAATCGTGGAGTGTACACGTCGGTTGTAGGCAATTTCTGCCAAATGGAGATATTCATCCCAGTCATTTTGAGCTGGGTTG
ACGACACCTCGAAGATAATCTCCGATAAATCGATTTGTCCGTTCCGTTTGTCCATCTGTTTGGGGTCGGAAAGCCGATGACAAGTTGTGCTGCGTACCAA
GCGCACTCACAATACTCTGCCAAAGTTTGGACGTAAACTTGGTGTCTCGATCGGATATAATGGTTTTGGGTAAACCGTGATCCTTTACATAATTCTTCAT
GAACACGTTAGCGATATCTGTGGTGTTGTCCGTTGTCTTCGTCGCAACGAACTTCGCTCGCTTTGTCAGCCGGTCAACGATTACCATAATCGCATCGCAA
CCTTTGGTGCTGACAGGCAGTGACACTACAAAATCCATTGAGATGTCTGTCCACCTACCCGAAGGTATGTCTAGTGGTTGAAGTAGTCCCGGCGGCTTGG
TTTGTCTCGCCTTGTTGCGCTGACACATTTCACATGTGTTGACATAGCGCTGGATGTACTTCATCATCTTCGGCCAGTAGTATTTCTCGCGTACTGCCAA
ATAGGTCTTATAAAACCCTGGGTGTCCTGCTGCTACTGCATCGTGATTCTCGCAAATGACTCGATTCTTCAGATCTTCGTCATCAGGGATGTACAATCGT
GGAGTCTGGTCTTCCGCAGTTTGATAGAAAAGAATGTCATCCTGTAAGGAGTATTTAGGCAATTCATCCCCTTGCTTCAGCTTCTTGATGATCCACTGTA
GATCCTTGTTCCACGAATACATCGACTTCGCCGTTTGGGCCACTGTCACCTTGTTTGGTACAATCGTTGCCACAATTTCACGATTCTTGGCTGCTTCCAG
TAGCTCTTGTAAGCTTACTTGAGCAGCTTTCAGTTCAAACTCTGGATTTCGTGACAATGCATCAGCCACGG