Description :
From Genome Similarity Track
Location :
Scaffold_2597:1508- 2870
Sequence
1362 bases(100 bases per row)
GCACACTGGATTGTACCCCGTTACAAAAGGAGCTCGACAGCTGGAAATGAGGCAGCAAAATTGCTTTGAATATTGGGAAACCACCGAAGGTACATTGTTA
GCTCTTAAATAAAGGATTTTTTAAAAAAACCAATCGTAATTTCCTTATAGGTTTTTTGGGCAAACTCGACACCAGCTCTTGGGTCTTTTCTTGCCATCAT
CAATTTTGATAAGGGCTTATTGAGTCATTTGTACTGAAATGATTGCACTGGTCAAATAGAATGAAAGTATGCGATTTTTTATTTCTATTGACAAAACGAG
GGCAACCTGGTAACGGCATTTCAAGAGGCTCGTGACAATACTGTTCACTTTCCGTATGAGAAGAAAACATCGTTTTCGTTTTTAATATGCACTGCAGTTT
TGTAGTAGTGTATAATTCATCCACGCAACTACTCGGCATCATGTTCCACATCGGCAGCTGGGTCAGCATCCGAACTTGGCCGCATGGCCCTGGGTGCAAC
ATATGTGGGCTGCCAGCAGACAGCAGGCTTCCAGCAGTGTCGGTAGGGTGCACCAGCTCTCGCGGGGTCCGCACGGGGTGTGGCGGTGGCATCATCGCCG
CTGGTGGTGGATTTCTCGACGGGACCACCGGAGACCGCCCTTCCGAGCTCCACCTGCAGGCATTCACCCAACGGGCAGTCTTCCACCCGCTCTGCCAAGT
ACGCCACCACAGCCCTTGAGGCTCCGTCCGCCTGCTGACACCCCCCTCGCTATTTTAAATTTTGCCGGCCCCCCGTCCTTATTTCTATCTCTCTTGTCGT
CGTCGCTACCCTTTTGTCGCTCTGGGCGCTGGTGGTCCGCCACCACCACCTGCCTTAAGCTCGCCTGTTTTAGAATTTTCAGTATGTGGCCCTCGATGTC
TAATCCAAAACTAAAATAAAGGATGGCTACTTTGATATGGTGTACGATAGTTTTGGTACAGATCCAATAAGGGAGGAGCTCGGATTTTTATTATGGTTAC
TGACAATTAGAGGATCAAATGGTTAAATTCAGTTATTTCCAAAATATAAACATTTTGACCCAGCTCACAGCTCTAATTGTAACGGGGTTACATGGTGTGG
AACACACAGGGGTACGAAGTACCCGGCGAGTTAACAAACTCTCAGTACATAAGTTGGAGAGTTAACAAGGTCTCTCAGTACGTTGGCTGAAAGCCACCCG
TTATGCATTTGATTAGGTTTAACTATGCTAGATAGTTAAAGAGATACATTTACCCCTAGGCCGCTTGGCCGCAATAATAGTAAATAAAGGACTTCTGGTT
TTGAAGCATAAAAGTTAAGGTGTTAACTTTGAGCCCTGGTCTTGGGCTGTAAGTGTCTTGGA