Description :
From Genome Similarity Track
Location :
Scaffold_2847:1508- 2728
Transcript NameFunction/comments
Phyta_totarag14877hypothetical protein

Sequence
1220 bases(100 bases per row)
GTGATCCCAGCTCCCAGAATCCCGGCTAAAACATCCTCATCTGACTTGATCTTGTGAATCTCCAGCGGCCACGGCGCTAGTCTCGCGACCCATTGCTCAC
AGCGTCCTTCCAGAGACTGAGATTTGAAGATCCATTTCAGCACTGAGTAACGCGTATacaccttcagcagtttGCTATCGGCCAACATCGTGTAGAATAT
TCTGAGGACTCTGAGCAAAGCCACCACTTCCTGCTCAGCCGGGTGATACCTGAGTTTGGATCATGAAGCACTATCCGGTGTATCGCACTGGGAGGATTAC
GTTGTCATACGTCTGGCCCAGTACTGCACTGACTGCCCAAGGATTAGCGTGAATGAAAATCACAAATGGCTTCTCCTTGTCAGGGTGTCGGAGAAACGGG
GTAGATAtggccttctgcttcggGATCTCAAAGGCTTCCTTGGCATGGCTGAGGCCTCGACCAGCACGAATCTGTTCGTCGGTCAACTAGTACAGCACTG
AAGCCACGACTGGAAGATCTTCAATGAACTTGTTGTAATAGTTCAGACTTCCCAGGAATGACTGCACACCTTTCAGAGTTGACGGGAATGGCAGGTTCCG
CACACCTTTCGCGATCTTCGGCTTGGCTCGGATCCCTTCCGCTCCAATCTCATGAGAAAATACGAAATTGTCTTCTTGCCAAACTCGCTCTTGGGCAAGC
TCACCGTAATGCCCCAGTAGCGTAGTCGATACAACAGACGGTTCAGGTCAATGCACGTCTGCTTCCAGGTCTCAGCTCCATACGCGATATCATCGATGTA
GGATCTTATTCCCAGGACTGGGTTCAGCTGAGGTGGGGTTGGGATATTCCTTCGGAACATAGTCAGTTCCTCAGACAACACTGGCATTTTGCCATTGTCA
ACTGAGATATCTGTCTCAATTCCCAAGAACTCCAGAACTTCAGCGTCCACCTGAGCTTCCTCGTTGGGCGAAAGTCGCACGAATCCCCAGAGACAGTTAT
CGAGCATCTGCTAGTAGATCAGGGGTGCATTTTTCAAACCAAACGGCATACGCATCCACTGAAAATGACCGAGCGGACAAATGAAAGCTGAGATGTGTTT
CGATCGGAGCGTCATCGGCACTGCCCAGTATCCACTAGCCATATCCAAACTCGGGAACCATATTGCACTTTCAACAAATCGTCAATCAAAGGTAGAGGGT
AGTGCATGAGCTTGATAAAA