Description :
From Genome Similarity Track
Location :
scaffold_147:15074- 16927
Transcript NameFunction/comments
g4594.t1 hypothetical protein PHYSODRAFT_555414
g4595.t1hypothetical protein

Sequence
1853 bases(100 bases per row)
GACGCCGACTACGTGCCTCCGCACCTGCGCCACTTCGTGTTCCACTCGCAGGACGATTTCTACGTGTCGCGCCACTTTGATCCGCTGCTGCTGAGCCATC
TCATGTACGAAGGATTCCTTCCCATCGCCTCGGAATTCCAGGATAAGTGCTTCCTACTGCCCAAACTCCACCGACAGCGCTGTTTACTGCTGATCAAGCC
TGGACAACCCGAGCACGTGCCCAAGATCGTCCGCAAGAGAGCCAAGAAATTCAAATTCGTACTTAACAGAGACTTTGATGGCGTCGTGCACGGCTGCCAC
GAGAAGCACGGCATCCCGTGGCTGTACCCACCCATTGTCGAGGGTTTTAAGACGTTATTCCAAGCTGGAGACGGCGGTGTGGAGCTCTATCCTGGAAGTA
AAGTTAGGTTCTTTACGATTGAGCTCTATGATGAGGCCACAGACAAGCTTGTTGCGGGGGAGCTGGGATACACTGTGGGCAGCGTCTACACGAGCTTGAC
GGGCTTCAGTAGAGCTAGTGGAGCGGGCACAGTGCAGCTGCATGCGTTGAGCAAGTTTCTGTATCTTGCAGGCTTTAAGCTGTGGGATCTGGGGATGTCC
ATGGACTACAAGATGAGTCTCGGGGCCAAAGATTTAGAGAGAGACGACTTTCTCGAGGAATTGTACAAGTGGCGACCTCATGAAGTACTGATGAAGCTAG
ACGAGAGCAGGAATGAAGGGGATGTCCGTGTGGGTGTTTCAGTTAAAGCTCTGTTGGATAATGCAAGACTCCCGACGGGAACGAATGAGGAAGAGAAAGT
TGAACACAAGGTGGATGGAGAGAAAGGTGGCAAAGACAGCAACGCCAATGGTGCGAAAGAGCATGGAGAGGAGAACGGGAAGGGCTTGACGGAAGAAAAG
CGCGAAGCTGGAGCAAAACGGAAACTCTCATCGGACGATGAGCAACAAGGCGAGGAGAAGAAGGGAAAGTCCGAAACGGTTGCTAGATCAGCAGCTCAAG
CGGATGCAAGCGCACAAGACAAAGCAGAAGCGGTGGTTGATGGCCACAGGCCCAGCACAGATTGAGCTAGACTACCGTGTACATGTACAGGGATGTTCGA
TCTTTCAGCGACAAGCCTCTCGTAAGAGGATGAGGGATTTCACAATGGTTTATTTGCTTTTTCTTCATTCCATCCAATGGGCTGACTTCAATCGTTGCAG
CTCTTGAATAACGTTTTGTACAATGGATACTGTGCCTGCTGTCATGGCTGATAGTGTCAAATTCGCGATATCTCACCCCTTGCGTTTCTCGTCCCGGTAC
ACAGAACGATGCGTTACCATTAGGCACAATGAGCTTGCTTGGTGACGACCTAGCTAGAGGAAACCTGCCTCCGAAAGACTATTCACGAACAGAATGCTCT
CTTGCGTGTTGGCATTCCGCGCCAATTGATACAGCACAGAGCTGTCTTTCCTGATACTGCACATCAATAATTACAACACTGTTAGCTTCATAAGCGAGAG
GTGAAGAGAGAATCACCAACGTACGTGTCAACCCGATGCCGGATATGAATCTGAGTCTTCCTGTCGTGCCGCAGGATGCCGCGCCCTTTCCTCGATACAC
CACCAGTAGTGTTAGCTCCATTGCCACCAGCACCATTCGCTCCAGCAGAGCTTGGGGGCACGTAGTTGAAATTTTGTCGATCTAACGCTTCACTGATAAC
TCGGTAGATCCTGCGGAACTTCTGCCAGTTCACGAGTCCCTCCTCCATGGATTTCATCGCTTCCTCGTACGTGAACAAATCCTTCACCAAGATAAACCAA
CAGGCGAGACGTGGCTGCCCTTCAGCCAGCGCAAACGCTTGGCGATAGCTCCG