Description :
From Genome Similarity Track
Location :
Scaffold_62:150737- 159308
Sequence
8571 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCACACACAACCAAGCGCATTACACCAAGGCCACGCGCAAT
GCCGCCTTCAACATTGCATCCAGCACCTTTAAAGACCTTTACCACGCAGGAACGGTTATTTCAAACCCGAATCTGACACCGCCGTTCTCGCCACGCTTAC
CCACCGGCTGGTCGTTGACCCTGCGAGTGCTAAGCCGAACCACTCTCCATCCTTAGCAATACTGCCATCCGAACGTCGTACCAGCAAGCACAACGAGCGC
TAAATACATGACGGAACGAAGAATTGAAAAAGCAAAGCAAAATTCCCAAACCGGGATTCGAACCCGGGTCGCGTGGGTGAAAGCCACTTATCCTAACCGC
CTATACTATTTGGGAGCACCTTCTATTAACCAAATCAAACGCCAAACACACGCATACTCACACACAACCAAGCGCACCATACCAAGGCCACGCGCAATGC
CGCCTTCAACATTGCATCCAGCACCTTCAAAGACCTTTACCACGCAGGAACGGTTGTTTCAAACCCGAATCTGACACCGCCGTTCTCGCCACGCTTACCC
ACCGGCTGGTCGTTGACCCTGCGAGTGCTAAGCCGAACCACTCTCCATCCTTAGCAATACTGCCATCCGAACGTCGTACCAGCAAGCACAACGAGCGCTA
AATACATGACGGAACGAAGAATTGAAAAAGCAAAGCAAAATTCCCAAACCGGGATTCGAACCCGGGGTCGCGTGGGTGAAAGCCACGTATCCTAACCGCC
TATACTATTTGGGAGCACCTTCTATTAACCAAAACAAACGCCAAACAAAAGGCCAAACACACGCATACTCACACACAACCAAGCACATTACACCAAGGCC
ACGCGCAATGCCGCCTTCAACATTGCATCCAGCACCTTTAAAGACCTTTACCACGCAGGAACGGTTATTTCAAACCCGAATCTGACACCGCCGTTCTCGC
CACGCTTACCCACCGGCTGGTCGTTGACCCCTGCAAGTGCTAAGCCGAACCACTCTCCATCCTTAGCAATACTGCCATCCGAACATCGTACCAGCAAGCA
CAACGAGCGCTATATACATGGCGGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCAGTGAAGGTAAATGCTTGGTATGGGGCAGCATGACAGCCCACATATCGAAATCTGTGAAGACTAAGTGCTCTTCAAAAAAATCG
ATGAGTGTTGTGCTTGGTGGCCCCACGCCTTACTTGCACGCTGGATATATTAGAATTTATATGCGTTTCAAGGACCTACTGTACATGGAAATTATCGCTT
GCAATAAATCAGATCGCCGGAACCTACGAGCTTACTGGAGGCTCTGAGAGAGATTGATGAAGCCGAGCCTTGGCGCATCCAATTTCGGGGGAATCCCAGC
CAACATCCAGGACACCGGATCCAGCGTCTGGCGGGCAAATTCCTCAACGTTCAGCCCTAGACCACCTGATCCATACCGCTCTTTCACGCTGCGCCCCCAG
TTCCAGTCTCCGTGGATCCGTCTCGTAGTAGTAACTAGTGGCTGGAAACTGGGTCGATTTAGTCTGTTTGCATAAGCTTTCTTAATCCACTTTTCGTTTC
TTGATCGTGTCTTCTCTAACATTCTCTCGTTCGATTGAGGGCCATGTCAGATCCTTGGTGTACACCTAGATCTGGGCTAGATCCACCCTTTCCGCGTACG
CCTGGATCTGGGCTAGATCCACCCTTTCAGCGTACGCCTGAATCTGGGCTAGATCCACCCCTGGCTCCAATCCAAATCCGTATCTGGATTCGTACCAACT
TCTGGATCCGAACGCCTGGATCTGGGCTAGATTCACCCTTTCAGCGTACGCCTGGATCTGGGCTAGATCCACCCCTGACTCCAATCCAAATCCGTATTTG
GATTTGTACCAACTTCTGGATCTAAACTGGATCCGCGCTTGGGTTTGAGCCGGATCCACCTCTTACGGCCGAGTCACAATTAGACCAGTATGGTCCGAGC
ACTCGAAAACTCGCGTTTGGTCCGGGACTCTTTGCACGTAAAAACGTCACTCTTTATGCATAAAACATTCACCTCTTCCTCCTAATCCACACCCTTCCTG
TGGGTTCTCCTTCTCTTTTTCTCTAATATGACCAGCTCACATCAGGGATCCTCCTCCTCCTGGCCCACACTCTTCCTGTGGGTCTTTCTCCATTCTCCTA
TCGATATGACCAACTCACACCCATGGATCCTCCCCTTACTCTTCTTTATGAGACTGCCTTCACGCCGAATCGGTTCCGATTCGTACGANNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNCGGACTCCCTTCACAAATGCTTCATCGAGAAATCTGGGGGCTAGATCCCAATCCTTCCTCTGGATCTAGTGAC
AGTCATAAGCTGAACCGTACTTTTCACGGATCCAACCACCACCACTTCGTCTAGTCCGTTTAGTGTGATGAGATCCTGACGCTCGGCCTCTCTCTCCACC
TCAACACCACATTGATTTCGTAAGCGGCATTTGCCAAGCTGTCCGCATTTGCATTCCAATTTGGCTTGGCATGTACCAGCTCGTGCTTCATCCAGCCACG
CAGGTGGATCATCACCTTCTGCCGTAACAGCGTTAGTACCGGGGCCTTGCAGTCAATTTCACCTCGCACCTGTCTGATCACCAAATTTGAATCTCCACAT
ATCACCAGCCTCTTCTATTCCTCCTTCTTTAATAGATCCAACCCCAGCAGGAGGCCGTTGAACCCGCTTCATCGATGGTGAGGCCTTCCGCGTAAGTGGG
TCTGGCCCGAACCACTTCCTATCCGGGCAGTTTCCACCGAATTGCGCTGTAAGCTCCTCCTCCGCGTCGCACGCGAGCAGATCCATTGAGACTCAGGACG
TACAGATCTTCATCCACTTGTACCGTCGGAATCGGGATCTGGATCTGGCGTTTGGGCTCTTTCTTAGGAGCGATCCTAGTCAGTGCTTCGTCCATGTTGG
CTCTTGGCGTGATGCTCGCGGCCAAAACGCCCAGGATCTCGTCTTCTCCTTTCGAACATTTTACGATCTCCAGTGTTCATGGTGAAAGTAAGGCTGCCCA
TTGTCCCAACCGGCCTTGTAGACCGGCCGACTTAGACACCAGGCGAGCGTGGAATGTCAAGTCAAAATCCGGATGGATCTTCCCACCAGCAGGTTATAAT
TAAGATTCAACACCCGCAGGAGTGCGAGTATTTCCTTCTCCACTGCTCCGTAATTCAACTCGTTCGGCTTTAGCGTTCGGCTGACGAGGGTGACCGGATG
GCAGATCACCTCATGTTCTTGTACCAAAGCTACTGAGACCGCCCAATCACTAGCATAGACTATCACCGTAG