Description :
From Genome Similarity Track
Location :
Scaffold_223:15071- 17809
Sequence
2738 bases(100 bases per row)
CTTGCCGTTCGTACATACACAAAACCACATGAAATCCACTACCGCATCCAGTTTCTCGCCAATTTTGCTGCATGTGAATAGTCCAGAACTGTTACCGATA
CAGACGTAAATTATACAGATAATATGAGAGGGTTGCGGAAATATCGACTTGATGGATGCGCGCGCACAGCCATTTGAATGCTTGGCAAAACGCGAGATCG
GGATATAGGAAGTAAAACAAAGTATCAAGTGGATGCAAGCTTCCTATTGAAACAGATGTCGAAGAACCAATTACCAGCAAGCGCATGCTGCGGTCATCAA
CCAATCTCGAGAATCACTAGACAGAAACCATCATTCCTGAATTTCATCGACAAGCCTCCAGACCTTGTCGTCTACTGGTGCATAGGAATTGCAGATACTA
TAGAAAAGTGACACGCACGTTGCATGCATCTGGGATAATGGCTTTGCAGAAGGGTAACGTAAGGGACGGTGCGATAACAGACGTAGGAGGCCTTGTTTAC
TTGTGACCGACCCTGATGAAGGTAACTGTATATGCATCAGGACTTGAATTCAAGTTACACTGTGCGTTGTGCAATTCAATTTATGTGGGATATTATATGC
GCGATTTGTAGAAGATACGAAAGGCACCAGCTCCTGCCTCTAGAGGGGAAAGCATCGTCGAGACGGAATGATCCTTCACCGTATACCTACAAGCCGGGGG
CAGCGAAGTTCAAGCTGCCGAAGATCTGGGCTATGGGAAGATATATGCTGAGTGGCTGAAAAACTACCAACTACTTGCTTTGCATCGAGCAGTATACAAT
AGCTTCGTCGGCGAAAGAATAGACACGTCAACCGAAGAACAATTTCGACCCGATCAAGTTTTGTTGGTCATCCGCTCCAACAATTAACTCTGGGGCAGAA
GATACGATCTCGAGTAGCAACTTCCACGTAGCAACACTTACGACAATTGCAAGTATACAGCAGGCGTCGCAGAACGAATAACGTCAAGGACGGCAGTGAA
TGACGAGACTGCATTGGACGAGCACGCACAGCAAGTTGACGTGATCAAAATTTGTGTAAATAGTCCAATGAGTCCAAATTTGAAAACGATGTCAGGTCTC
AAAACCTTTCGTAAGTCTGTCACTCTAATTTTTCAGATAACAAGAAAAGTCGCTGCAGAAAGCGCAGTGACGCCACCATAGTATATGATTGAGCCCAGGC
GACGACCTAGGGGCAACGACGTATCTGTAGTCTTGACAAGAAGATCAAATGTGAACTACGCTGACGAAAATGACGTGAACTTCAGTACCGCTGACGTTAG
TGACGTGGAGCATGAGGTTGCAAATTCTGAAAATAGCTCCGAGGCAGAAGAGACAAATGGACAAAAACAAGCGGAGAAGAGTTGTGCCAGAGGGTTAGTC
AATTTTTCAGGAGACTACTGATTGTGGGCAGAATAATTGCGCAACAAAGTAAATTGATGACGTAAGCAGAGGACGACGACCGACTTTTTTCTGGAGTGTG
GACGAGGAGCATTTGTTATGTCGTGGCGTGGCAAAGTACGGTACCGGCAAGTGGAAGAAGATATTACTGAGCGGTAAAGGTGTGTTTTCAATTCATCGAA
CGAATGTGGACTTAAAGGTACGATAGGGAGCTTTTGCACTAGCTTTGTCATTGTGTCTTTGTGTTGATGTGATGTGTCTGCTTCTCAGGACAAGTGGAAG
AATATGCAAAGAATGAATCACATCAATTGCAAGCGAACCGCCGAAGTACAAAACTTGGCGCGTCACAAGCGGTCTAGTGTAGCACATGCGACAAGAGTCG
CTGCCGACCAATCAAGATCTGGAGGTGGTGTGGGCGAGTTGTCGTCAGTGGATAGTGTTGAGCTGAGAACTGACCCAAGCACTGCTATGGCTGTGGGCGC
GATGGCTGCTACTGATCAACATGCGACTAGAGTTCGCTGCATTCCGGTTGAGGCAGACATATGTAATGCTGTTGACCACGATAAAGGTGATATCCCCGAT
GCGACTGGATCGTTCCAGACACCACGCCAAGTTGTGTTACAGTTCGTATGCAACAGTAATTTTCCTGAGGTACGTTTTCGCTACTCGCATCCGTGTTCTT
ATAATAGAAAGTCGGCACTCGTTTTTGATTATCACTGTCACTTGATGCAGATTACAAATGTCCGTGTCGACTTGGACACATGTAAGGATGTACCTACTTT
AAAGAAGCTGCTACGCTCGAATATCTTGTCGGGTGCGCCACCGAACGAGGACGTCCAGATGATCGGCCTCACATCAAGACAGTTTTTTCAACATGACGAG
CTTTTACTGCAATGCATGAGGATCAACAACGGCATAGACTTTTTTCTGGTGTTCGACGAAGCCGCAGCAGTGTTTGTGTAAGCAAGTGAGTGGTTCTAAA
ACTTCGTGGCTCACTGTATTTTGTCCTAACAGACTTTGCGTCATCCATAGTTTGTGTGTGTGTAACAAGATGAGCCCGTCTCATGACCAAAATTACTAAC
ATGAAAGTACGGCAGAAATAAGATAGGGGTGCAAGCTCTGGAGCTCGCTCTTTGATTTAGGTAATCCAGTTCGGAGAACTGAATCAGGTTGCAAAACACT
ATACAACAGCAGCAGTCACTGAAGAAGGAGTATGATGCTATTAATGTCTAATTTAACCCAGAAGTGTCGATCACATGATAATATTCACTTTTGATCGATT
TTAAGCCAATCACGTGCATGCATCACAATAGTGACGTA