Description :
From Genome Similarity Track
Location :
Scaffold_19:15071- 16799
Transcript NameFunction/comments
Phyta_totarag1114conserved hypothetical protein
Phyta_totarag1115hypothetical protein PHYSODRAFT_542654

Sequence
1728 bases(100 bases per row)
AGGCGGTGGAGACCAAGAACGCCTGGGCCTCGCTgcatgacgacgaggacgaggactaGTCGGTTGGTTGCTCGACTGAGTTAGGCGCGCTATTACTGTA
CTGTGAAAAAAATGGACAAGCAGCCGCCTTGCTCACTGCGAAGCTCATTGAGCCTAGCAGCATTAAAATCTGGGTTGAGCAGGACAGATGAGTCGAATCC
AAGAAATTGATTGCAAGGCAGTGGTGGATGCTCTGCCTGGCCGGGAACTACTGGGAgaatgctgctgctcatctGTGTGACGGCTTGTCACGTAACCGAA
GCGGTGTGGCAAACGGAGCTAGGTGCACCATGTGCAGGGAGGAGAATTGTAATAGAACGGCGCGTCAGGGTCGAGCCAGCAAACATCAACTAGCAAATAC
GAATCGACCGGGCGAGTTCTGCTGCCTTGTTTTATGGAGTGGGCGTCGACTTAACCTCTCTCCGGGGTATCCATGGTCTCGAAAGTGCAGCCCAGGTACG
AGCTGTAGCCGTGTGGTTTGGCGTGTGGCACGGCACTGCCGTTATGCCAGATGAGGTCAAATCCACCGATGTGCAGCTCGTTGCCCTCGCGACGACGTTC
CAGGTCCACGACATCTAGTGTGTGCTGTACGAGGTTGGTCTTGAGCGCATAGTCGGCGTCCGTATCGCTTGTCAACGATGGCGAGGCGTTTACCTCGATT
AGCCACGGTTTAAGCGCACTATCAATGAGCACATCGTAGCCGTAGAGCTCAAAGCAGTGTCGGTCCTGGATAATCGTTGGCtgcacagccagcagcgagc
gtgtGATGAGGGGCTGTATAGCGAGGAACAAGCGGTCAACGGCTTCTTGGCCGTGTTTGCTGATGAGGAACATCTTGAGACTGTGTAGTGGCCACTTGCT
GCCAAGACGTTCGTCATAGTCGTCAGCCCCCTTCTGCACCGAGGCGTTCGTGAGGTGCATGAAGAGATTGTCCATATCACCTTTGCTCTGTGAGTAGCGG
GCGTGTGAAAAGCGAGCAAACCCCGCACGGTAGATCCAAAACGTCAACGGCGAGAAGCtcgtcaccagcacgtaCAGTCGTAAGTCGAACTTCTTACCGC
CAAGCAGGTATGGTGACTCAACATACTTCTGCACGATGTACGTGTCGGCCGTCTTAGCCTGCACCGCACCGTCGCCCTTCCACGAAGGATCTCGCTTCCA
CTCGCTGATGTCGCTCAACTTCTCGAACAGGAAGATGCCTCGACCTTGTGCCTTGCCGACGGGTTTCATGATCCATCTGCCGCCTGCTGTGCGTTTGAAC
TCCTCGAGAAACATACCGTATTCGTGTGGCAGCACAAATGTAGCCGACCAGAAGTCGTAGAGAACCGCCTCGCGTCGtgcttcagcgtcgccacttcaac
accaagcTGCATCGTCAGtaacatggctacatttgagccacatggctacatcggAGACCTACCTGCGCTCGAGCTGCCTTCTGATGCGCTTGAGATTCTT
GACCAATAAATCCTTACGCGTGAGTTCATAATGGTTCTGGAAGTGGTTGATCCGCTGAAATCCATCAGACAAACAATGAGTTTTCACCTTCATTCGTCAA
GATCTTCGTACGCACCTGGTGATCTTGAAGCGGCGTGAAGGCGTCCAAGTTATCGCGGATCCAACCCACGTCGGCCCAGTGCAGGTCCCAGTCCAGGTCG
CTGTCCGACTCAATCCAGCCGCCTTGGC