Description :
From Genome Similarity Track
Location :
Scaffold_70:150671- 152769
Transcript NameFunction/comments
g6145.t1POM74471.1 Integrase catalytic core protein [Phytophthora palmivora var. palmivora

Sequence
2098 bases(100 bases per row)
GTTCTGCTCCTTGTCGAGTGCCTCAATGTTGTTGACGTGCTGCGTGGTCGCAACCACCCTGTCCTTGGGCAGGTACACTCGGTACCCCTTGGCTCTTCGC
CCACGCCGACAACCATGGCAGGCTGGGCACGTTGCGCGAAATTCTTCTTGCGCGAATCCCGGTAGACCGTGCACGGCGAGCCGAATACGACGATCTCACC
CAGCTGCGGCGACTTGCCCGTCAACACCTTCAACGGCGACGCACGCCCTGGGTTGGAGTTAGTCGGGCGCGGTTCAGAATGTGCGCACCGTACTGGACCG
CGTCACCCCAGAACTTCAGCGGGAGCCCACACGCGAAGATCATGCACCACGCCATGTTCATGATGGTGCGGTGCATGCGCTTGGCCTTGCCGTCGCTCGA
GTAGTTCCGCGCTTCGCTGCGCTGTCGGGTCACGCCCGTGCGTTTGCAGAACAAGTCCACGTTCTCGTACTCTCCTCCGGAGTCCGTGCGCAGAACGTGG
ATCTTGCAGTCGAATTCCTTCTCGAAGTAGACGAGAAAGTGCTCGAAGAGCTTCACCGCGGCGTCCTGGGTACGCGCCAGGAACACGTGGCAGTAGTTCG
ACTTATAGTCGATGAAGTTAATCATTTACCCATTCCCGAGGCAGTCCTCGGTCGTCATTGGCCCTTTCAGGACGGAACAGATGACCCCACCCGATTGGTG
AGTGGGCACCGGTGTCCTTCTTGGACCGCCGGTTCTTTGTCTGCTTGCCTTCGGCGCACGTCAGTCAGTTCATGCGCTTGTGGCCCATTAGGTGGATCCC
GGATCTCGGCTCCTTAGCCAGTCGCTCCGCCGAATCGTAGATCAGGTGCGCCAAGCGCGTGTGGAAGTCCAGTAGCGCGTCCTTCTACACGTCGACCGAC
ACTTCCACTGACTCGGCGAGCTCCTGGTATAGCACGGCCATAATCACATCCGACGGCAAGTCATGCCTTCGCCTCATGGCAGCGGGCACGACCAACACGT
TGCGCCGCATCTCAACGTCGAACGCTACGCGTCCACCGTCCTTGGCCGCAACGACGCGTCGCCCGGCTCGCTGGGTCAGCTCAAAGCCTCGGTTATCGAG
TAGCTCATAGGAGATGAGGTTGTGCTCCACGTTCCTCGCAAAATATACATTGGTGATCTCTACCATCTGCTCCTCACCGCACGCCGTGATACGCAGCATC
ACCCTACCACGCTTGGTGATGTTCAGCGACTCACCGTTGGGCTGCACGCACTCGTCGCTGCACTCTTTGACGTCCTCGAGGAACGACTCGTCGTTCACGA
GGTTCACTGTCCACCGTCGTACTCGCCGGACTTCTCGCCGACGGCCAGCGCGAGGTGCGCGCGCTGCTTGCGGTCCGGGCACGCTGCGCGCAGGTGACCC
ACACGGCCGCACTCGTAACAGCTGCGCGTCTCCAGGCGCTGGTTGTTGCATCCCCTCACCGCGTTAACCGTCTCGCGGCCTAGCGGCTTCTGCTTGGTCG
ACTCGGTCTCCCAAGACCGTTCGAAGTGCGCGAGCTCCTCGGCGTGCCGCAGATAATCGGTCCTTGCTTGGTCCACCTTGGCCATCAACACCGTGCGTAG
CTCTGCGGAGGCGTACTGAACGATGGTGTTCAGCACCAGGTACTCGACGTTGGTCCGCCTGGACTCGGAGATGGCCACGAGGTACATATAGTGCTCGGGC
CACGGTCTCTTGGTGTCTTTTGACGCTGTGAACATCTTCATGGCTTGGGCGGGCGTGATGTTCGTCTTGAACGCGTCCAGTATCCGCTCCATCACGTACT
GCAGCGTGGGCAACTGGTTCCACCACGTGTCCACCTGCTTGTTGTAGTATCTCTCGGTCGTACCCGACAGGTAGTGGCCGAGATGGTCTACTTTCACGTC
CTCCGGTCACGGGAAGCCGCACGCCTACTGCCCGAGCGCCACCTGCCGTTTGAATCTTCTGCCTCAGTCCAGGAAGCCGGATCCCAGCCCGACGTACAGC
TCCACGCCGTCGAACGGACGGATCACCAGCTTCTTCTGGCGGGCGTCCGGGTTGCGGAACGCCCCACCCTGGTTCTGCGTAGGGATGGCTGGTGGCTG