Description :
From Genome Similarity Track
Location :
Scaffold_198:15061- 21634
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_198-snap-gene-0.24Chromodomain-helicase-DNA-binding protein
Pytul_var.sporangiiferummaker-pug3_contig_198-fgenesh-gene-0.6Conserved gene of unknown function

Sequence
6573 bases(100 bases per row)
GCGTACGCGCCACGCTTCAGGAGCTCGACAAGCTGCTCCGAAGACGGTTTCTCAACTTGGGCTGTTTCACTGAAGGATGCGGTACCAAGGATAGCATGCT
CCAACCCAAGCTTTCTCGACGCGCGGTCAAACATCTCGCTTTCGTACGTGTTGCGCGTCACCAAGCGGTAGATTTGTACAGACTTCTTTTGACCGATTCG
ATGGCATCGGGATTGAGCCTGGAGATCATTCATGGGGTTCCAGTCACTGTCGAAAATAATGACAGTATCAGCAGCGATCAAGTTGATACCAACACCTCCC
GCTTTCGTACTCAGCAGGAACACAAACGACTTGGAGTTTGCGCGAGAGAAACGATCAATAGAGTTCTGGCGCATACTTCCACTTGTCGATCCATCAAGTC
GCTCGTACACGAAACCATTAAACTCACAGTAGCGCTCTAGCATGTCCAGTTGCTTCAAGAATTGACTGAAAATCAAGACTTTGTGGCCTTCCGCCTTAAG
TTTCGGCAGCAATTTGGAAACCAGAACCATTTTTCCCGAACATTGAACGACTTTGTTCATGATATCTGCAGGTGGTGGACGTGGACCCAATTCCTCCAAT
TCTCGATCCTCAACTCCTTTGATGAGGAATGGGTGGTTGCAGCACATTCGAAGCTGCAACTGGATATTGTTGAGTGTCGGGAGCGAGTTTTTGGTGCCTC
TGAACAAGAAACTCTTGTTCTTGTCGTAAATCGCTCGGTAGTACTGCTTTTGCAGCGTCGTGAGTTCGACGGCAATAATCGTTTCTTCTTTCGGCGGAAT
ACTCTTCTCAACGTCTTCTTTTACACGACGGAGAATGTACGGGCCCAGTAACTTTTGCAACTCTTCGACTTGCTCTTGTGAGATCAGCTTGCCAAAGCTG
GCATTGAATTTCTCCATATTGTCAAACTTGACCGGTTCCAGGTAGTTCAACAGCACCCACAGCTCCTGAATATTATTCTGAAGAGGGGTACCAGTGAGTA
GCAGCTTGCGGTCGCAACGAAACGAGCGCATTTGCTTGAGCACACGCGACCCGGAGCTTTTCAGACGATGCGCTTCATCAACAACGATTAAGCGCCAGTG
AATTTGCTCCATCTCTTCAAAATCAGCCAGCAGCGTCTCAAACGTCGTCAGCAAGATATTGAACTTGAAAATCGAGTTGCCTAGCCCTGGATAGTACCAT
TCTTGATCTCGAATGATGCCTCTCATGTCCTTTGCTGTGAAACGGTTACTTCGATCTCCAATGTCGTGATATACGCACACATTGAGGTCGGTCCAGCTCT
CGATTTCACGCCGCCAATGTTGGATTGTCGAGAGCGGAACCACAATCAGATAAGGTCCGCGGATAGACTCTTCGGTTTTCAGATGCTCAATGAACGAGAC
CACTTGAACCGTTTTTCCGAGACCCATCTCGTCGGCAAGAATAGTGGATCGTTGTGCTTTGAAGCACGAAATCATCCAGTTCAAGCCTTCCACTTGGTAT
TCGCGCAACGTTCTGCCACCCTTGTACGTTGGAGACTGCTCGTACGGGATGAATTCATTCTTGTCACTCCCACTTCCATCGTCGGCCTTACTGTCTTTTT
TTCGCTTTGCAGGAAGGAAGCTGGCAAAGTGCTCGTGTGGATCAATGCTGTTGTCGATGATGCCTGAGTACAAGTGCTGCATCGGGCCATTCGGTGAGAT
GTAGTTTGCCTGGTTCGCGAGCGCCTGAGACACCAAGGGCATGGTTGAGGCTGGGGTGGAGCCAACTTTCAGCATTGGCTTGTACTTGTGGTAACTGTAA
TTGATGAACTTCGATTCATCGGCTGCACCTTCCAGCGTAGTTTCGCGTTGCAGTATCGCTTGTCTAGCTTGGCAGTATGGTGGATACATGTATGCAGCAC
GTCGGGAATGGAAATGAAAGAGAACAATCTCCGGAGATCGGCCGATCACTGCAATCACATCTTTGAACGACATCCCACCAACGTACACGTTATTCACACC
AACGAGGACATCGCCCACAGAGATCACTTGCGAGGCCTCGGCCGGTCCGATCGAACCATTTGGTAGATTTTGGAATCCTAGTACCGATGCATTCTCGTTG
TCCGCGACACCTAAGCGCATCCCAAGACCAAATTGTGTTCGTCGCAAGGCAACACGATACTCACAGAACGTCGGGAGGCCTTTCAAGCTGGTTGGCTGAA
ACTGAGAGGTATACTTCACCTTTGGAGGCACAGGAACAAGTTCGGTCGGGTATCCAAAGGCAATGTGTTCGACAAGCGAACTCACAACTTCGCTGACCTC
CTCGTCTGGTTTCTTCTTCGAGAAAAAGTCAGCATCACCATCGTCAACGTTGTCGACAAAACCAGGGTACATTTGAGGACGAAACGGTGGAACTTCATCG
TCATCGTACTCCTCTTCCTCAGACGATTCGCCTTCGTCTTCCGAGTAGTCTTCGTCTTCCTCGTCCTTGGAGTTTTTCGCTGTGCCCATCAAATACTGCT
TCTTACAAACGTACGCGTTCGTGAACACACCACACTGCTTGAGCACGTCTTTATCTGGTGTGTGGTTGTTCAGTAAGCAATGGAAGGCGTACAGCTGCGC
TTTCACTTGCTCAACCATTTTCAGTTTGAGGTACTCTTTGGTGCCGTAAGCCTTCTCCAAAGACTTGATTTCACGGCTGCAGTCACCTTCATGCCGCCAT
CCAAGAGTGCAGAATCGATCTTTATCACAGCATTTTTGAGTGCCGCTGTAGAGCAAGTACTGATTCCTCTTTGCACAGCACGGTAATTGACATGTGGTCT
CCATAATTTCTTTGGCAGTCGGAACGCGGCTAAACTTGAAATACCGTTGAATCTGCTCGTCATCTCCGATATCTTCTGGTCGCTCCCATGTTGAATATTT
CACGGATACACCAAGCCACTTGACGAGAAAGACGGTCGCGCGATCGTTAGGATTCGTGGAACCACTTTCCACTTTGGCAGTTAGCGCATCACCGTCGCTC
TCTGTAGCAGTAGTATTTGCAGTCTTACGGTTGAACTTTTTGTCTCCTGTTCCAATTTGTTGGCGTAGGATACTTGGAATCGCTACCGATGTCGAAGCGG
GTATCGCTTTTTTTGGTGAAGCTACCGGCCTCTTGACGTCGACTTTATGCCCAGCAGCATCCGCACCCCCTTTCATCTCCTTTGACTGCGCGATCTCAGC
TTCTTCGCGTTGCTTTGTCTGTTCCTCAATGGCGCTGATTGCGTTTTTCTCAAACTTGTTGCGAACCTCGCAAAACGCACAGTACCATTCTCCCTCAGGC
AGCTCCGTGATCTCAGGCGTCGAGCAGTACATGTGAATCTCCCCATCGCATCGGTCACAGAGCAGCAATTGCTCACTGTTATCGCTATTCCGGCAAATTG
AGCACCCAACTTCCCATGGCGACCACAGATCGTAGCTATCTTCGCCAACTTCTCGGAAGTCGTCCAGCAGCTTCTTATCTGCTTCTTTGTCCAGCGTTGG
CTCGAGCTTTAGCCACGCTGACGGGCACAAGACCCAGTCATAAATCCACTTTTCAAACATTTTTGAAAGATCGTCGGCGATCAACCAAATGTCGGATTCG
GCGGCATTGAACTCCTTACAGTTGGCAAACACAAGGCGCACATCCGATATAAACAGCGACACCGCAGCCGGTCCGATATAATAATTCTCTCGTGCCAGCC
GCGCCACGATCGTACCCAAATCCATCGGATTCAAGATAATGTTCAGGTAATCGGGGATTTCTCTACAAGTATCACACGAAACAGTCCAAAACAAAAAAAT
GTCGTTAGCCCATAAGCACTAACACACTATGTGGAAGCGGGCTCGCACATTATAACATGAACGTACTCTGTGTCGACTGGATGCTCGAAAACTTCACCAC
CGTTCTCGTTCAAAAGCTTCTTCACGATCCCCGCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCACATCGGCGTTGCTGAGTAGGAAATAAT
CCGTCACACGCGGAAATCGAGGCGCAAATGAAAACTCTTGGCGGCGCTTCTCGATCTGGTCGTCGAGTTTGTCACGCAAATCGACGCGATGGCTCAGAAT
CTTCTCCACTGTCACTTTATTGACCTCGAGATCATCGACATCGTCGAAATCCTGGTACCCTTCGCGGCGCAATTTGCGGTCATAGAGCTGCACACGGTGT
TGTTTCTGGTAGCCCTCGGGAATGAAGAGCTCCAATTCGTCAAACGTCAGCCACCACAGGTGCAGGTAAGATCTTCCAATGAACTTGCACAGGTATTCCG
TCAAGCCACTGCGTTTGTTGATGCGCCGTCCAACGATCTGGTCCAACTCCGGGTATTCCGCGTCCTAGATCACGAAAAAACATGTCAGTCAGCATATTAG
TGGTCCATTTAGCGTGTTTGAATGCTGCTAGCGTGATGACGCACCGATCGGACTTGATAGTCCAATTGACGCGCTTTCCGCTTTTTCTCGGCCGCGACGA
CTTCTTCGACATCCGAGCCATCATCTTGGACGTATTTGACGTTTTTCAGGCTCCTTCGACGCTTGCGTCCACCGCCATTGTCGTTCTCTGCAGTTCCATC
CGCTGCCTCCTAATCCACGATTAACACACAAAAAAAAACGTTGTGGCACTGAGCATACAGACGATTCACATACGCTGGAAAAAAATTGATACCCTGTTCG
CGTTAGACAGCGTACCTTCTGCGGAGGCTGCTGCTCACTCGTAACTTGCACTTGTGCAACTGGAGTTTGTAGCTGTTGCGGCTGCTGCTCGGTCACAGTA
GCTACTTGCGACTGTTGCTGTAGTGGCTCGCTCGTAACAGCTACTTGCGGCTGCTCACTCACTGGCTGCGCGACGTCGACCACAGCAGACGGAGCGATCT
CTGCACTCCACAGCATACAGCAAAAGCATCATAAAGCAGTGTCATTAGCATATCGCATTACAAAAAAAACTCATGACTGGAATAGATCTCAGTGCGTGGT
TCCCCGCAGAGAGAACCCAAGGCTGTGCCGCCATTGAAACTGCCTTGCGCTCATATACACAATACACACACAAGCAATCTATAGTCGCACTGTACGCCTC
TATAGGACCACGCGCAACTGCCATGTACGTCCACGCACCATCTATCGGGACGGCGTCGTCCATGACGCGAACGATGCAAAGACGGTTTGTTACTCTTTTG
TTTTTATTCCGCGCTTTCCTTTCTTGCTTGCGCGCGCAACCAACTCAAGTCTCACACGCGAGCAAGCAAAGGGTTTTGAATTGGCGTGAATCGACTGCAA
ATGAATTGCTTTTATATAGCGTTTTGAATGATGCAATTCAATGAATTGAGAATTTGGTTTTCCCGCGCTCCATGCGGTTCGCTACACGGTTACGTACGCC
AATTATTGCAAGCGGCACAAAAGATCCCGCTGCACTTCACACGATGCTTGAAAAAGACATGGCTACTCTTTGTGGCCGACCACATGCACCTTTTCGGTAT
CAAGTCTCAGAGGCTGACTGTGTGCATATTTGTGTGCGCTTGGTGAACGCTACTGGGGTCTTTCTCTATCAGGAAGCCACAGGCGCGTAAGCATACCTCC
AAAAATCGCAAATCCATCCTTTTTTCGTTTCTTTCGTAGAGGTCCAGGTGCAGCGCCAAGTTCGCATACATTTGGACCGTCAAACGTGCATTTTGGTTGG
AAAGAACGGTGGAAGCATGCGAACCTTACGAATTGAGGGAAAGCAGATCATATTTCCATAGTCATAATAACAAGATCATAATGAGTTGGTTATACTGAGA
ACAAGCAAAAACGAAAAAATGTAGAGAAAGAAGCGAAATAAGATGGCGACACTATCCAATCTGAAGCAAATCGATGAGACACATAGGAACAACAGATTAT
GATATAGCGCAATGGGCGTTGCAGCATGAAGACTTTGCCATTCTCTATGGGTCATAAAACAAGCACTCGAGCTGGAATGGATCCTTTCGTTCACGTGGCT
CTCGTGGCAGATCCTCTGGCGCTTGGTCTCAGCAACGCTGTCGTCCAAGAGCTACGCTGTTGGTCCGTTTCAGCACCAAAAACCGCATCCTCGACTGTTA
TTTTCCTCCCACAATTGACGCAACAGAGTCCAAATTTGGGCTCGAAACACCAATTTGCGACTCTCCTGCCTCCTGCAAAGCTCCTGAAATATCGAAGTCC
ATACAAACACACAGACACAATGGCGCATGGCTCGACACCCAGCATGGTTCACCCCCTTGCGAGTCCTTCATGTCCAGAAGCCGCCAACCAGTCGTCGTCG
TTAGATGACAATCATGAGCAACAGGAGCAGCTCCTTGGTGACAAGACCACCTCTGAACCCCAGGCCGAGGAAGACCAAACGCTCTCGAGTGCCTCGTTCT
ATGGACAGCAGGCATGGGCGTGGCTCTGCTGGTCGGGCGAGAAAACGTGGGACGGCCTGGACTTTGCCGGCGAAGTCGTCGCCAATTTCCTGGGGCTCAC
GCGGTCCAAGTACCAGTGGATGATCGACCTCCAGGCGCGTGAGGAAGAAGACAAGAAACAGCGGCGACTCGAA