Description :
From Genome Similarity Track
Location :
Scaffold_219:15060- 18164
Sequence
3104 bases(100 bases per row)
TATACTCAAGTTAACGTGGTAAACACATACTGACGTGATGCTTTGATTAAGAAATTTACCTATTATAATCACCATTCACCCGCAATGTGCTGATACGTCT
GACTTTCATTACATCTTGAACTCTCCACGTCCAGCGTGCTGTCCATTAAGTCTAAAATCATTAACATCACCAACTAATCCCTGCAACAGCACTGAAGTGT
CGCCATCAGCCTTGGTAAAGCCTTCAAATTAGTAAAATGAGAGTCAACAGGTAGAATAGGTTCATGATAGTCTATTTAATAGTTACATATGCGCTGAGTT
GCTATAGGATACGAGCGGGAAGTGAATGTCTATCCCACAACAAAACCAACTATAAAAGCACCACTGTAGCACCAAAACCACCACAAAACAATACTAACAC
CACTAACACTAACAGCAGTAGCAAGAGCAGCAGTAGCAAAGGAACAGAAGCAGCAAAATTAACAGCTACACCAGTACCAACAACAGCAACAGTAGCAACG
ACAAGAACAAGAACAATGGCATCAGCAGCAGCACCACCAGTAGCAGCAACAGCAGAAGTAACAAAAGCAACAGGAACATCAAAAATGTTTACAGCGACAA
CGGCTACAGCGGTAGCAGTAACAACGACATGAGCAACTGAAAGCAAACTAACAATAGTACCAATTATAACATTAGAAACAATGAAAACAATGATAAAAAC
GATAAGAAAAGAATACCATCAATTATAACAACATCAGCACCGGTTGTCTACATTTACGGTCGCGGCCGACGATACAAAGACGCGTTTACATCTTACTGTG
TCGTCCGCGCCCACCACTGATGGCTAAAGGCGCAGGACGTCCGCGGTAGAACCCCCTCCGCGGCTCCCCCTACAGGGCGGGGGTCGTGCACGGCCGTACA
ATGAAAATTGAGATATGACTAACATATGATTTTTTATGTGTACCACGTTAACTTGAGTATACATGAACGTGGAGCACTTTTATTTTCGTGATTAAATGGG
GCATTTTTTATTTTCCCAAATAAAAATAGGGAACTTTTAAATCCACCACACCTTTTTACTGAATTCACCACATTATTGTAAGCCACACCACATATCAAAT
TGCTATTAAATGCGATAAGAGATTGCTTATACACATAAAATTGAAACTTTGGACTAAACGCAGCGTACAAAAGCCCGTTCAGCACATCCTACAGCCTACA
ACGGGAGCTAGAGAGATAGTTTACCATACAGCGAAAGTCATTTTGTCATAAAAGAAACTCCGATTTGGCTTAGATTGGAACTTCTTTCACGAAGACATAG
AGTACTCAGCGGGGGTGTATAGCGAGAGCGTTCAGGATGTAACGGGGCATCGACCGCTTGTAATTTAAACAGTACAAGCTACTTTCTCTCAACACAGGGA
AGCAGGTGCCTCTAATATCACGTACACGTATCGTGCAGAGGAAGGTTTCAATACGAGATAAGAGAAAAAGTAGAAATGTATTTAGTATAGGAAATCTTAT
GTTAATGAATCCTATTTAGTATTTATTTAACTAAATACAAACATGTATTGTGTCTATCTGCTCACCACTCATTGCGTTCTACTGCCGTGGCTCGGCTTTA
TTGGTCGATATCATTGCCCTATATCAATTAAAGAACATTATATTACTTCTGCATCAATACACAATATTACTCGTAAAGATAATAGTGTGAGATTATGATG
TCTGTCTTAACATCATATATATACTTGATATTTACCTTATGTAAAATATCATGTAACAGAGGCACCCCGTTACACAGAAGCTATCCTTCATCTTTGCAGT
CTTAATCCTATCATTGCCGCAATAGATGACAACATGGCAAAGCGGCAATCTAACAGACTGACAGCTCTAGATTGCGCAATCCTGGAAGCTACTGCATATG
GCCGACCTGTCTTGGTATTGACTGATGAGGCCATGCAACAACAGTTTTTTCGTATTCCACGCCAGAAAAGGGTACGGAACTGACATTGTTGCATGTGCCA
ATTAATTACTGGTGCAAAGCAGAGCTTATCCCAGAGAGTACATTACCCCTGTTGAAGCTGTCTGGGAACATCATTCTAGTCTAGAACAACGCGAGTTTTA
GGTGCCACAATTCAAAGATTCGTATAGCGCGTTTTAAGCCCGCTTTTTATGAGCAGAATTAATTGATTATACAGTAGAGTCAATGTGGTGTAGCGCACAA
TGATGTTGCGATTTTAGTTAAAGGTATGGTGGATTTAACAATTTCATCAAAATATACCACTTCTGCGGAGAAAACTACACCTTAAGATGACAAATATAAA
ATAAACCATAAGATTGGAAAACAAGGTAGCGGAGCAAGCATCAAAGCTCGCCCTTTAAAAATATGAGAGCAGGCCTGGAGCTCTCCCTTTAATATAAGTG
ACCCGGTCCATGGAACTGGATCAATTTCTGTTTTTTCGTGTACCATGCGATCGCCCACTAATAGCTTCTTTTTTCGGGATCGCAATAATGCCTAATAACA
ATGAAAGGGAACAGCTGCTACATCACACTCAGTACGACGTATGAGGTATACCTATCGTTATCTTCACACATTCAAAAGGAGATGATAGACTAAACCGCAC
TTATTTACGATGTCTATAGTAATTCTGGCGTTACTAACAGGCAGACAGAGAGACACCAAGATAAGTGCGATTCAAACAGTTCAGCATTCACCTTGCGTAT
AGTCACTAGTAGCTCCACCATTCAATTAATGAAAAGTGCATTATGTTTGATTGGTCAAATTAAAAAAAAAACATTTCTTAAAACGGAATGTCAATCTCAT
CGCAAAGATTGAATCTTTTCTTTTTCAACCGTACGCGCTACTTTTCAGCGCATGTCGGCGCCGTCGCCACGTGTATAAACACACATTTACCAAATATAAT
TTTTCCAAAGGAAATCTTACCGGCTCTGGATGCTACCTACGACACGCTGAAACAGCGTCGGCATGCGTATAATGAACATGTAGCAGGCAAAAGTATATGA
AATGATTTATCCTTGTAAGAAGGTGTGCAACACGAAAGGCGGAACGTCGAAATTAAATATGTGTGGTTGAAATGGGGTTACTCAAACGATTTGTATGACC
GGTA