Description :
From Genome Similarity Track
Location :
Scaffold_2033:1506- 3345
Sequence
1839 bases(100 bases per row)
CTGGCCAAACTATCCGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCAACCAACCACGCAGGTGGATCATCACTTTCTGCCGTAACA
GTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATTACCAAATTTGAATCCCCACAAATCACCAGCCGTTTTGGATCTTGTCCCTT
TAGTAAATCCAAACCCAGAAGGAGTCCGTTATACTCCGCTTCATTGACGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCGTACAACTTCCCATCCGGGC
AATCTCCACAGTATTGCACTGTATGCTCCTCCTCCGCGTCGTACACGAGCGGATCCATCGAAACTCAGGACGTATAGATCCTCATCCACCTGTACCGTCG
GGATCGGGATCTAGATCCGGCGTTTGGGCTCTTTCTTAGGAGCTACCCTAGTCAGCGCCTCATCCATCTTAGCCCGAGGAGTGATGCTCGCGGCCAAGAC
TCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTTCAGTGTCCAAGGCGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGCAACCCGGCC
GACTTGAACAGCCAGGCTAGCGTAGAGTGTCGAGTCAGGATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTGAGATCCAACACGCGCAGGAGCGCGA
GTATCTCTTTCTCCACCGCTCCGTAGCTCAATTCATTCGTTTCAGTGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCTTCATGTTCTTGTACCAGA
GCTGCTGAGACGGCCCAGTCACTGGCATAAACTATAACCGTAGGTTGACGTTCCGGATCGAAATGACGGAGGATAGGTGTGGTCGCGATCCTGTTCCTCA
GCTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGGTTTCGCCTCTTCCAAACTCTGGTCCGTCGTCTCTATCCTGATTGGATCCTCTTCCTTTTGGTC
CCGGGGCGGATCCGGCTCCTGTTTTAAGACCTCTTTTGGCGTCGTACTACTTGGATCCCTTCGTGGATCCGACATCTCCCGGGCCAGAGCTTGTTGGATC
TTGATCCGGACAGCTGAAGTGGTCATCATAGCAAAATCCACCTCTCTCAATTCATATAGTACCGCAGCAAACAGTGCGTAATCCTCGATGAACCCGACTG
TAGTAGTTCAAACTGCCCAAGCAGGATTGCATCGCCCGTAGCGACTGTGGAAAGGACAAGTCTGCCAACGAAGACAGGTCTTTAGGGCTCGCCTCCAGTC
CCTCCTTGGAGACTCGATGACCTAAGTAATCCACCTTGCGCATCCCCCCAATAGCTCTTTACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCA
GTAGGGATGCCACTCTCTCGCACAACTGATCCCACGATTCCGCCGGGATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACGGACGGGGTTCCAGG
ATCCCCTGGCTCTCCTGCTTCAAATGGATCTACTTCCGTATGATCTTCCCCGGATCCACCCCTTTCGGGTTCCGGTATTCGGGTGAATCCATAGAGGGCG
TTATCGATCAGGCGTTGGTAGATCTGGGGCGCATTCTTCAATCCAAACGGCATCCGGTTCCATTCGAACAGTCCGAACGGTGTGATGAATGCGGATATTG
CGCGAGCTCGATCCGTCATAGTCATCACCCAGAAACCACTGGCCATGTCTAGAGAACAGTACCAGAGTACTTTATCCAAATCTTCCAACAGCTCATTGAT
TAGAGGCATCGGATACACCATCAATCGAGTCAGGCCGTT