Description :
From Genome Similarity Track
Location :
Scaffold_61:150572- 152417
Sequence
1845 bases(100 bases per row)
ACTGCTGTCCTCACAGACTACCAGCACCAACACGATGATGGCCTCCTAAGAAAATGCAGAGATGGAGACCAATTAGGCCACGTGGTGGCTGACGCGAATA
CCCGTGTGGAGGAAGGACAATGGATTAGCTGCAGAAAAAGGAAGATGTACAAGTAGATAAACATATACGTAACTTTACCTGTAGCTGCTAGTTGAGGATT
TGGCCATTGCACTCGACCGCTTCGGGAGGCATTGCGAAGATTGTCAGCGGAGCAAGCGCCACGTGCTCAGGATCGCTGAGCTTTACGAGGTGGTTGTCGA
TGTCGATGCTGCTGCTCTTGGCCGAGTCCAGTTGAACATCTTTGGCTCCGTGGACTTCACTTTCTCAGCCAAAACCAAAGAAGACTTGGAGTTCAGATGT
TGAATGAAAATTTTTTTTCGATAGGAGAGAAGATCCCGAGCTACTGTTTGCTAGACGCGGGCGCAGCGAGCTCTAGTTCTCACTTTTCTATCGGCATTGA
GGTGCAATTCCCGCCTCATCACGCTCTTGATATTGAAGAGGCAATACAAGCGTTTTGCCCCCAGTGTCGTCATCAGATAGACGCCTAAGGAAATTATAAT
ATTGCTGTTTTTCTTGGACGGATCGCGCTGGTTAGCACGTCTAATTCTTGTAATTCTTCATCAGGCCGTGTTCGGTCGCGAGCTGTGGACTGACAACAAG
TCATGATGTGAGTGCAACTCATTCAGCACAGGGTTCTGGTCCTCTATCATTAAAACTTATGAGCATGGTCCGTAAGACAGCTTTCGTACCGAAAAAGAAA
TACCAGTTAGGTTTTTCAATAAAAAACCCTCGCATATGTGATTGGTCAATGTCTATGGGTGCGATTGGTTAAAAAATGTTCGTCTGACGATTTGTATGCA
CACGGATTGAGAGTAATTGACACGGAATTGCTTTTAGTAATATATCACTAGATTAAGCTCCGTTTACACTTTTTCTAGTATATTTTTAAGCTTAATTCTG
ATTATTTTTGACGACAAAGCGAAAAAAATTCCACCCCTCCATAAAGTGATAGCTCAAATGGTAGGAAAATTTGCTCATAAAAAAATTCGCTCTGACGCTA
CGTAAGTAGATCTTAAAAACTAGCTCAACCACGCTTCCGTTGGAGCTGTACGACCGAAGCTATCGTCGATTTAAAGAGCTGGTATTTCTTTTTCGGACCG
GAGAAGTATCGGTATAACTAAAGTGTGGAATTTGGGTGACCATTTGGCATCGGTATAAGCAAAGAGTGGAATTGAAGTGGAAGATATGGGTGGTAATTTA
GAATCCGGTACCTATGATCGGCTACTTGAACTTAACCGGATAATTTAAAATATATTGATAGGATCCAGGGTGTTATATGCGCTATCGAATACTTTTCATT
TTTACTCGGTCATATGTAAGACTATGCGCATGTTATATATTGTGTTATACATCCGTTTCGCTCGTCATTGGCTCACTGCACAGATCTCATGATTAGTCGG
TACGCTGTGGCTAGGGGGGGGGGCGTCGGACCTGCAAGGTTGCCGTGTTGAACCGCCTCGCGGCTCGGCAGCATTTCGTCCAGTGATAGATGCATCTTTG
TTCTACGGACGGATTCACCAAAAGACGGACACGCTTGTATAGTAGTGCTTTGGACTAGCCGAGCGCGGCTGCTTGGCGGCGGTGGGTCAGTGGTAGGTCC
CAACTGTTTAGGACACCTGCCTCCGATTTGCTCCGACGGGCTGATGTCTGTGTATTACACATCATCAAAGTAATTATAGGACAATTTGCACTGTAAAAAA
CGTGTTGTATTTAGTGTCAGATCACATTCTCAGACATGAAGGCAG