Description :
From Genome Similarity Track
Location :
Scaffold_210:15056- 20496
Sequence
5440 bases(100 bases per row)
AACGATTCCGACCTATGATTTTGCAGCATATAAAATGTGTACCGATATTCTAAATCATAAACTTGGGGAACAGGCTCACCCTTTGATTAGTGGTGGCAAT
TGGCAAGGGTCTGCAGCAGTTCAATTTTTAGCTGCTTTTCGTGCCAACGACCCGAATGGCAGTACATGATCATAACTTTTCGGGCTTAGGTGAGCCGGTT
TTATCAAACATCTTATTGATTTTGCAAACCACCTTGATAGCGAGTTTAAAGAATACCGGCTGCCATAATTGCTATTTTTAATATTGACAGAGTATGCCCC
ACCTCAGCGGATGCCTTTTGACCGCTCGCTTTTCTTTATCATCATCCTCTTTTAATCCTTCCGCGATTCAGTTCACTCACCCTTTCCCTTGGAGATCAAA
AATAAATTTGTAGACAGGACTAGGTACTTTGCGAAAGGAATGAAAGGTAGCTCCATCTTTCTGCTCTCCACAACCTCGTTGAGATTAATACTTCTGTAAT
GGGTCCAACAATTGCTGAGTCATATTATATTGTTTTGAATTACCGAACGCCTCTATACGCAATTATTTCCACAACCACATAATGAGTACACGTTTAAAGA
AGAAAATGACCAGTGAAGTTATAGAATCTCCCCATTGTGCAAACCTTCTGATATCGACATACTGTCTTATCATTCCATCCCTTAGATATAGTGCGATATA
AAGCTCTGGTGGCAATGTCAGGAACTCCTTATAAGAATAGAAGCTCATGATGTACAAGATCTCATCATTATAGAAGCAGTGCGAATGAAGGCCCAGCTGT
TCCGTATATAGTCATCGTTGTTCCTGCGCCGCCGGACACGCCATCTTTGTACTTAAATTTTCCATCCGGCGAATTCGAAAGTGGAACCATAAAGATAGCC
TGCTGGCAGAAGCTGCTAGCCTAAGCGGCAAGTGTTGGGCGTTTGTTTCTCGATGGGCCTTCTTCGGCCGTGGTCAAGGATAAAGAGATTCTCATCCACG
TTGTGCATGCATTCTTGTCAAACTGCCCGCAAGGTAAACCTGAAAGCAGTACACCCATAAAATAGGTCACATTTTTCTCGATTTGTGCCTTATTTTTGGG
ACTGCACATCAATCATATTATTTGCGATAGCATGACTATGATGTTACTACTTTGTTTGTTGTTATAGTAAATTTTAGTAATTGTTGAATCCACCACATTT
TTTTAGTAAATCCACCACATAGTAAATTTTAGTAATTGTTAAATCCACCACACCTTTTTAGTAAATCCACCACACTATTATTGTAAGCCCCGCCACATGC
CACATTGCTTTTAAAAACGACATGTATTTATGATTATATTGAGAATTTGGTTGAACAAGTATACTATTGGCAAAGGATTCTTGGTGTTAATGTGGCTGCA
CTTGAGGCGCGGCTTGAGTGGAAATTAAAAAAGTTGGTTGCGCCGCAAGCCAACTGGACGACTGGTTCAGATTACGCAATCCGGGCCGCTAATGCATTTT
GGTGACCTGTAGTGGCATTGACCGACGAGGGCCATGTAACAACATATCTTTCGTTTTCCACGGCAGCAAATGGTGCGGAAATTACATTGCTGTGTGTGGA
AAAGTGATCACTTGCGCGCGGCAGAGCTAACCCCAAACAGTGCACTTTTTTCAAAAAGGTTATCTGATAACATCACTCTAGTCCAGAATAAACCGGATTT
TGGATGCCACACTTTCAGGGTCGTAAAGCGCGTTGGAAGCCCGTCATTTAGTATTAATTTGAGTTGATCATACAGTCTCAATATGATGTGGAGTACGAAT
ATGTGGTGGATTTAGTAAAAAGATATGGAGGGTATAACAATTCCATAACTTTAAGCCATGTATAATCTCTCCAATACATATGAGATGATGTTTTAAAAAT
TGTTGAACCCTGCGCGTCTATCTCATATCGAAAATGGTATAGTGTTAAATAGAGATGCATAATTCGCGTTGTAGATGTTGGACGAACTAACAATAAGCTC
GAAAACGACAAAATCAAGTAAAATTATAAATGCTTTTGATCTGAAGTCTTAAAAAGAAATAACGCCTCAACCAGACCTGTGAACAAGTCTTCGACCCAAG
TAGAGCTTATCGGACATTTCTACCGAAAGCAGCTTAAAATGGATCGATTTCAGTGATTGGTAGGGCATAAATTAAGATTGACATTTTGATGTTCTCCAAG
CTCTTCCAAGCATTCCACAAACGCGATGCTTTAAATGATTCGCCTGTATTAGAGTACTCAACATTCGTCAAATTTATCGTATAGAAGGACATACTATACC
GTATCATATATTAGGTGAGATTACTAGATTCTACTCGCCGATAAACGCTTCCGAAAAGTGGATAAATGCACAGAATTGGACGCTTCCCTCTCCATAACCA
TCTTCATCTGAACCAATCCGTAGCATGATTTTTTGATGCGCGCCTGTAAGTCACACCTATCTTTAAATGGCGACTGCGTGCAGTTTAAAACATTCTCACT
ATCAGGATAAATGGTCTCGTTTATTATGCGCACTGACATCTTTTGGAGTGTTTGTAGTCTGATTGCTCTAATTCGAATGCTTTCATAGAGCGTGAATGTG
CGGGCACGGCAACAAATAGGCGGTGGAGCGCCCATATCTTCACGTCTTGTCGAAAAAAGATCAGTCGTCTATAATGTAAGGGATAAAAAGAGAGGTGCCG
AATTAAAAATTATTAGAAAAAATCGAGTGAGACCATATCAACAGGAATTAGTGTATAATATACTTATTCTCAATACACAGTAGTTACCATCGTACACCGA
ATACGGTGGACGTTATAACTTACCAAACCCGGACGCTTAGTAGAAGGTAGAAATAAAAACTGTATAATTAACAAGGAATCGTTTATTAGGCCCACCTCTC
CGTCATGCATCCGCCTCCTGCCAATAATTTCTATAAATTTGCATTATTTTTGACAACAATTGGCTTTTCTGTGAAACAATAAAAAGGCCTTACAAATAAA
GAGTATTTATTAAAAATTCAGGGTTATTTTTTCCTCTCATTACATTTAAAAGTGCTACTAAAGCAATAGATACTAAACAAGTATTCAATTCTAGCCTGAG
CTGATCATATGATTCATACTGCATTCGATTTAGAAATAGCGCCGACGGAATCGTTGAAGACGAGTGCCGAGCTGGCGCCTTGTCCCAAAACTACAGAAGG
AATTCTAAATCAGTTGGTGTGTAACCGCGTGTCATAGTTGGTAAAGGACCGACCGTGAAAAGAGAAACTTGTGCTGCATTATGATATACGAGGTAGAGGG
CGCAGGATGCAGCGAGCGTGCACTGGAGGGGTCGAATTTTGCTTATTGTTGTAATTTTGACGATTTGATTAAAAGGTAGACGTACAACAAGAGGCCATAC
AGAAATGCAGCATCAGTTAAAGATAGATCACGTTGCACGACAACTTGTTCACCGGTCGGACGTGATATAAAGGGAAAAGAGATACATTATCGACGGTGAA
GGTGTCTATGTGATCAAGTCCTGGATGGACTTATATAAGGCTACTAATTATGAATACCACTATTCTTGTGCTTAGTGGAGGGCTAAGAGATATTTTATAC
CAATAAAAAATGAGAGTTGGTCAAATTTTCAACTTGTCCTGGTACAAAATCATACTAAAAAGGCATTTTAGGGCCTCCAGTAACGTTTCCCTGTACAAGT
GCCCTCGTTCATAAGTTATTAGCGATTTATGTATTTGTTACCGTTTGTATAGGCGAGCTAGACTTCACAACCTTTTCCCTTCTACATTTCTCTACAAATT
CGATCGCGGCACAATTTCGCATTCTTACGTGTGCAAATAGATTATCTGTGGCTACCTCACGATACGGATAACGCAGCGGATCTAAAATATTTATGTACGT
GAGCTTAAAAGGTTGAAGTAAACTTTCTTAGGTTAAATGAATTAATTTATATATACTTATAATGTCGCCTTTCTACGTGTAGTTGTATACTTACGATACA
AGTTAAATCTGCTTGAAAGGCTTAAGATACGATTATTCGTACAAATGTTACTTCTTTCAAGTAAACGAGAGCTATTTTTGTGTGATTAAATACGGTGATA
AAAGTCCGTCTGAATACCGTACGATAACTTCAAAATAAAAAACATGTCAACCTGTATTTAAAACTAATTGATATCTGGCACGTTATTGTTGTTAAGCGAT
TGGAGCGGTTTTGACAGTTGCGTGCAAGGTTGAAATGGCAAGGATCAAGTGCCTCAATTAAGATCAAAACGGTCCTGATTGGTGGATCAAAGCTGCTACT
GGCTAACGATCTTAAAATCAAGTTCAAGAGATTTTGAGGGACGATGCCTATTGAGATCGAAGTAAAAGTACAGCTATCAAATGAACAGGGCAAGATATCG
GATGATTTCCCTCCGATCCGTGACATAAAGATTGCGATCTTGGGGTATGCCAGATGTAAGTTTGGGAGAAACACATTGCGATTACGCAATCGGACATGCA
ATGAACTAGTTACGATAATGTGGGGAAGGTCTGATAGGAGCGGGGAGAGAACGAGGTGGCTTACATGCTGCAATCCACGACTTTCGAATCTGAGAAAAAA
ATTGAAAGATGTTGTGAGAAATTTCAATCAGTAGGTACTACAAAACGTGCCCGTGAAACTCCAGGATTTAGACTACATGCCACGATTTGTGATCCGATTA
TCCGCATACTGGACAGAAGAATCGAAATATGTTGCCTGGAGTACAGAACCGGTGCGCACCACAAAAAGACCATGCTATAAACTAGGGATCGCGATTGATT
CCACGATCGTGATCCACGATCCGGAATTTGCAATCCAGCTGTTTACGCACTTCTTTTAGACCACAGAGTACGAGGAGGAGATTATAACGAAGGGGCAACG
CGTAATATCTCATCCTGGCATACGGACAAGCGTTGTCATAGTTTTGGGTTCGGGTGGCTAACGTTGACACACAGCTCAATTAATTCCTAAAGGGATGCTT
CGAGTTCACTTTCGGGCTGGTATCTGGAAATCTATTTATATTCCCCGCCCTTACTTTCCCCGCCGTACGTAAACATTGTCCAAAACCACAAACCACACAA
CCTGCTGACGGTAAAACGCGTCGCCAGAGTCATCAGTGGCCCTTTATGTTACTTTACGTGTTGAGGTAGGAGGAACCTATCGCTTTATTAGTGCAGCTCC
TCGGTCGAGGATAATTGGATCAGAGGAGATACTACACTTGGTCGTTGCTAAAAGGCCGAGAAGATATGGAAATGAAAGAGGACGAAAGAAAAAGGAAGAG
GAGAAGGAGAAGAAAAAAGTGAAAGTGAAGAAGAAGAAGAGAGGGAAGAGGCAGTCGAGGCTCGCTGTTTAGATGCTGTAACGTTAACACCGAAAGTACA
ATATCAGCTTTGGTCAAGTGGGCGCGTGTGCAAGGCGTGG