Description :
From Genome Similarity Track
Location :
Scaffold_4:150556- 151885
Transcript NameFunction/comments
Sapdi_VS20SDRG_01752hypothetical protein

Sequence
1329 bases(100 bases per row)
CTCTTGGCCGCGCACAAGCTCACGGTGTCTCTTGCGATTGTGTCTCTAGGACGGCGAGCAGTCGGCCAACTTGCGCCGCGCCGCCGAATTCGTCGAGATG
AATCTCAGTCAAATGGGCAAGGACGAGCGGCGAACACGTATCGGGTACAAGGACCAGGTTTGACAGCGTCGCGCCTCGATCACCATCCAGTATTCTCTGT
GTACTTAGATGAAGCAAAAGGCGTGCCGGCTCATCGACCACACGGGCGCCAACCTCGACCTGCACGAAATTGTGTGCAATCGCGCCAAGAAGATGTTTGC
CGAGTTTCGCGACCTGCGCGAACACGTGCACCAGTTCGAGGCCGTCGTCGCCGGCTGCATCATTGACGCGTACCTCACCACGGGCAAGGAGATGTACACG
GCGCAGGCTGCTGTCAAAATTGGGGCCAAGAAGCAAGGCGGCATTGCGCAGCTGCAGCTGCCGGCGCATAAGGCCGTCGATGACAAGAAGCTGCATCCGT
TCAGCTGCGCCAAGTGCGGGCTCATCTTCAACGCGAAGCGTGGCATGCAGTTCCACTCGTGCGGCGACGACGACGCGGACAAGAAGACGAACGTGCCGAC
AACACTGGACCTGAAGCCGCTCGACGTGCCGGATGAGCTGTTGCCGATCCGCGAGATCAAGGACAACAAGGAGTGGTTCCGCTGCCCGCTCTGCCAGCGC
ATGTACACCAAGCTCGAGACGGCGAACGAACATATGCAGCGCCACAAGAAGCAGAGCGAGAAGCGCAAGGTGCACATCGAGACGAGCAACATGGACACGA
CGCGCCTCTCCAAGACGAGCACGCTCGCCAGCGCCAACCCGTCCGTGCAGGTCAACACGCACGAAAGCGTCCTCTTCCGCGGCAGCGGGCGCCGGCCGTG
GCTCAAGCACATACAGGAGGAGTACGAGAAGCGAACCAAGGACGAGGAAGAGATGAAGGGCTAATGTGTCGATACCGCTAACAGACAGCTCTCTTCTAGC
GATGGCGTGTATGCGTCCATGTCGCGTTAATACACTACTAGTACTACTATTGTGAATTTCAGCCGGTTTGGCTATTCGAGGCACCAAAACCTCGTTTTAT
TAAGCTAAATCGAGGTCGGACCTGGATTAGAGCGGAGCCCAGCCTCGATTTATTTTTTAAACGAGCCGCGAAATATTTTTAATAAAATGCATCACTTGCA
ACACATGGTGGAATTAGGATCGTAAGTCCTGGTTTTACGACTCTAGCGCGGAAGTTGCTTCAAGCGACCTCGTATTGGACCCTGCAGCTGGGTCCAAAAC
GAGGTCGCCATAAGCAACCTGATAAGCAA