Description :
From Genome Similarity Track
Location :
Scaffold_71:150549- 158160
Sequence
7611 bases(100 bases per row)
ATTTTCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTCGTAGTCAACCCACGGCACCGCGGGTAGACTATCTGAACCTCTCCGAAGT
TCGTTGCCATGAATAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGCCCTGCAGAG
CCTGGTGGTGTCAACACCGGCCGAGCAGCTCGAGCGCGTCAATGCGTTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTGCGGGAGAACCTGCTGGCT
CCGGCGGCGGAAGCAAATCCGCCTCACCCGAACCCAATACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGAGCCTTCACTTCTGGGTCCGAG
AAGTAGAGCTTGCGATGGACGCAGCTCTGATCTCGACCGAGCGACTTCGTGTTGCTTTTGCACTCTCCGACCTTAGCGGTCGTGCTAAGAGTTGGGTGTA
CACACGGGAAGCAACATCCCCTGGATGTTTCACACTCTGGGCTCAGCTGTGTGAGCAGCTCCGAGCCGCCTTCAAGAAGCGTACAGCCATCGCCAGGCGC
GTACGCCGGCCTCAGCGTGGCTTGGGAGGTCCTTGTCGGCTCCCGGTCGAACAAGCCCCAACGGACCAGTTCCCATGAAACTCGGGTCCGCCGAACAGCG
TGACATCCGCTGCTTCGGCTGCGGGAAGATGGGCCACTTCAAGCGCGACTGGCCCGCGGAAAGACACCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAG
GGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGAGAACGCCGAGAACCAGTAGGGGCGGGGCGCCATACTGGGGAAGAACTAAGTCTTCGTGATGGGTG
CGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTCTTCGCACTCTCGAATCGGCGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTA
CGGGGATGCGATCATCCCTTTAGAATCCAGATCGATTCTGGGGCGTCGAAGAATTTCGCAGACCACCAGACGGTTGCTCGTAACAGCAACAAGTTGTCCG
AGGCTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAGGTCGTCACTGTTCCCAATGTCCAAGTGGATCTGGTCGTCAA
GTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCCATATGATATGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGG
ATCGACTGGCGAGGCAAGGCAATCGATGCCAGCCGCCCTGTGCAGTCCGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCC
GCAAGGGTTGACAGGGTACCAAAGCATCCGGCAGATGCTTGGGAGTCGTCGACGTATATGACGACTCCGAGGATGTTTTGATGGTGGCAGCGCCCAGAAG
AGGCGCTGGCCAAGTGGGTAACTTAGGTCTACAGGCGGGTAACTTAGCTCCGCAGACAGCTGCAGCTGTCACGAACACTGAGAGCAGCGTGTTCAGAGTG
GGTAACAGAGTTTCACTCACGGTCGCCCAGACCTTAACTGAAGAGGAAGACGTCGGATACGCTTCCTGTGTGGGTATCGCCCAGACCTTAACTGAAGAGG
AAGGCGTCGAACACGCTTCCTGTGTAGGTACCATAGTACCACACGAGGCCACGAATGCCTCGGATGTTGTAGCGCCGACATCCCTAGACGTGGGTAGCAA
AGCTCCACGTCACGGTCGCCGTCATCAACGACGCCGCCGCCGCCTCAAGTCAGATCCGAACTTCGTTCAGATCGACGTCGCTTCAAGCGTCTCGGGTCCA
GGGCCCGGGCTCCTCAGTGCTATCACATCTTTGATGGTGAGACCGGTTTACTCGTCAAGGCATCTGGTGTCCACTTGAAACCGTTGCCAGAGGTTGCAGA
GATACTGAACCTCGAGGAAATGACGGTCGAGTCTTTCCTGGCCAACCTCAAGGCTGGAGAGATTGCTGAGATGGTGCTCATGAGACCTGAGACCACTCGG
GAGGAGCTGAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGACCTCAACAAGCAGCGTCAGACGCGCTTGGGTTCTGAGATCCTTGAGAACCCCA
ATGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAACAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCATGAGATTGA
TCTCGTGCCCGGCGCAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCA
GGTATGGCGCGGGAGTCAAAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGAAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTG
GACAACGCAGCGGTGCCGGCCCAAACACCAATCCCACGAAAGGATGTGTTGTTAAACAACATGGCCGGAAGCGTACTGTACAGTGCGCTGGATTTGGTAG
ACGGATACTACCAGATCCTGATGTGAGAGAGTGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGG
CTTGTCTAACGCCCGGCGACGCTCAATCGCCTGGTGACGCAACTGCTCCGCCCTTTGCGTACCTTCGTACAGGCGTACTTCGACGACATATTCGTCCATA
GCCGTGCCGAGGGAGGCAAGACGGCCGTGGAGGGGCATCTAGGACACCACCGTCGAGTGTTGGACGTAATGCGAGCAAACAAGCTCTACGCCAACATCGA
CAAGTGCGTTTTCGCGTCACCAGAGATTAAAGTTCTCGGTTGCTTCGTAAGAACGTGGGCGTTCGGGCTGACCCAGACAAGATCAAGGTCATAGCTGCAT
GGCCAACGCCCCGATCCCAAAAGGATCTTTGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCCCAGGGTACGCGGGCTTCGCTAAGCCCTT
GTCGGGCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCATGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGACCCCTGTCCTG
GCCCTGTCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGGTGTGCATTGCTGCAGACCGACACGGTTGGACATGAAC
GAGTCATCTCGTTCCAGTCCAGGCAGCTCAAAGCCGCCGAACGGAACTACCCTGTCCACGACAAGGAGCTCATGGCAATGAAATATGCCCTTGTGAAGTT
TCGTGTTCACCTTCTGGGCTCCCGGCCCTTCGTGATCTACACAGACCACGCGTCCTTGAGAACGGCGACTAACTCGCCTCACTTCTCCCAAAGAATGGCG
AGGTGGCCGTCCTTCTTCGTGGAGTACAGCTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCGGACAATG
AGTTGGCCCACATCACACGGGTAACAACGGATCTATATGACGGAAACGCATAGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTCGCG
GCAGGAACGAGCGCGAAGTCCGACTGACTCTTGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGATGGCCTCCTCTATTACCGGGTGGAGC
CCAATGAACCTCCTCGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGATATCCTCGCGGAGGCGCACGACGCGCCCTCCAGCGGCCATTTGGGCCG
CGAGAAGACCTTTCTGTCTGTCTCTCAGGCCTTCAGGTGGACCCACATGTACAAGTAGGTCGTCCGATACCTTAAGACATGTGAAACATGTCAGCGGGTA
AAACCCGTAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGACTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCG
ACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTACTCCGGTTCACGTCACCGTCAGAGGCGAACAAACCGC
GAGGTTGTTCGTGTGGCGTGTTCCGCTATCACGGTCTCCCGGAAACGATTGTCTCGGACCGAGACCCGCGGTTCACTGCTGCGTTTTGGAAAACGCTATT
AACTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGATCATCCACAGACAGACGGCCAGACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGC
AGTGTGTGTGCGGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGCTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGT
TCTACTTGAATGGCTTCTGTCACCCCAGAGTGCCTCTCACTCTTCGAGAAGACACTGCCTCCTCTGCTCTAAGTGGGGGAGAGGATCGGAAAGCCCTTTC
CTCCCAGGTCTCGGATGTGAGACCCGTCTCGCCGCGGAAACAAGTGGAATCCTTTATGGATACCAAGCTAAACGTTGTCAGCAGGGTCCGCGATGCCATG
GCAGCGGCCCAGGATAAACAAAAGGAGTACTCCGACAAACATGGAAGAGGAAACTTAAGTGTATTTAAAGTGGGGGACTTAGTGTTACTAGACACGAGGA
ACCTACCTCTTGACACTGTCAGCTCTGTCGGCAGCAACATGCTGAAGCACCGCTTTATCGGACCATTTGCAGTCCTGGTCAGACATGGTGCGTCGTACAC
CATCGACCTGCCAAAGTCAATGACGACGCACCCGACGTTCTATGTTGGACGTCTTAAGCGGTACTTTGATCCGCAGGGGGTTGCTGACTCGCAGTCCCAC
CTTGACCCAGCTCCTCGAAGCGAGGGACGGTCACAGACGTCGACGAGGGCATCGGAGCAGGCACCCAAGCCTCGGTCGGAGCGACAAGGCTGCGGTCAAG
ACCGTACGCCGGAGGGGCTCCGTACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTAC
GTCGAAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCA
GGTGCAGGCTCGCGACCTCTCGTTCCACCAGGTCCAGGCGGCCCGCAAGGCGAGCGATCTCGCCCTGATTCCCGGCCTGGGCGGCAGTATTACCGCCAGT
ACCAAGGCCAAGTGCAATCTCAAGCAAGAGGACACGTTGGCGGAGGTGGTCAACCTCAGGGTCCTGTGTCAGACCCGCAGTCGGAGCACTCGGACGAGAG
TGGCTCTCGGGAGGTGCCGAGTACTTGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTC
CAGGAGCAACGGTGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAATTCGTGGGAGCCGATTGAACGACTCCTGATTG
ACTGCCCGAAGGCTGTCGCGATCTGGGACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGAGGTACGGACGATGAGTACATAC
CGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGGTC
ACGCTGGTCCAGGATGCGGGACAGCAGCTGATCTTCATGGAGTTCCCGTAACTCCGTGGGTGAGTACTTAAGAGTCTCCACCCACGCCCAGAACATGTCC
TCACAAGAACTCCACGTGGGACAGTTCTCGGGCATAGCCCAGGGGTATCCCCAAAGAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCG
TGAAGTCCTTAAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGTTC
GTAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGTGGAGCGACGAGAAGCTTTAAGAAGATGTCAGCTCCGGAGCTCTCCTCGGGAGGCCAATAC
CCTCTTGAGTTGATGGCAGCTCTCTGGCTGACGAGTACCACCACCGAACCCCCCCCCCGTACACGCTGGGCAGCTTGGAAATCCTTCTGCTGCTGGTCGA
GGTCATTCGTGACCTCCCGGGGCACAGAGATAGCACCCTCCTCTTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGATTCGATAATGCCCCGATG
GGAGTGCCGAGTCTCCTTCTCCTCGTGGAGTGGAGACTTAGAGGCTGTACGCTTCTTTGAGGGCTTGGCGCCTTCAGCTTTAGAGGCCTTAGCACGCGCA
AGACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCTCTTCCTCATCGCCACCAGCTTTGGGAGTGCCCTTAGCCTTGACGGCCGGACTCTCAGAGCGCA
CAGACGTCCTCGGACTGTGATCACCTTGATCACTAGCGAGCGTCTGCACGCTGTCCTCCTTGTGCTCGCTGGCCACTGGGCTGTGCCCTCCCACAGAGCC
CGCAGGAGCATCGTACGTGCTATGGGACTTGGCTTCGTCCTCACTGCCAGAGTCGAACTCATGTTCCACGATCCAAGGGCTCGGACAATTGTCTGAGGCC
GAGGGCGACGGGCTGCGGCGCTTGCTTGTTCGCTTGCCCATAGTCGCGTCACCCGAGGAACCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTAAGTG
CCGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCTTGCGCCTTACCGACAGCAGCCTTGGAACGTGTCTTAGCACCGCTCTTTGCAGTGCCACGAGGCAT
GGTAACGGTCGAATTGGAGACCTAGACGAAGAGCGCACAGGCTGCTGCTCGAGGCTCTTACTGTGAAGTGAGCCTCCGCCGCGCTCGCGTGGCCAAGTCG
ATGGTTTTCGACTTTGAGAATGAAAGTTTGTGATGAACACCTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACG
TAGCCCTAAGTGTACCCTGGTTACATGAAGTATGACACGTCATACTTCGGGATATTTGGTACAAAGTACTAAGATCGTTCAAAGCCAACCATTGGTTAAC
GACATTGCATCTCTATATGTGACTTATAGTTTGTATTAAACCCAAGCTTTATCTACCTATATATATATACTAAGTTTACATTCTACCTAAATTAGGCCAC
TTCGCTCTCTTTTGAATAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTGGGAAGCTAACTTCCTCTAGCGCAAGGTGCTGTGTG
ACCCCGTCACA