Description :
From Genome Similarity Track
Location :
scaffold_27:150549- 152782
Sequence
2233 bases(100 bases per row)
ATTGTGGAGGTCGTGTTGCTACAGTCGGAGATCGATTTGGCGGAActacgctcatcatcatttATGGATGATTCGGATTTCGGCGGTTTTCGACAGCTTG
TGGAATCACACAGTGGAACTGCTATTCTGGAAATTAACTACCCAAATTATTCACCTTTTACGGAATCTAAGGATGACAACCTTAGTGCGATCCCGCTTCC
TGGACTTCCGCTTAAATGTAGAGATCGATACGAAATTGATTGTGAGCTTGGTCTTAAGCATACAGCGTGAACAAGGTGAGCCTATCAATGAGTACTTTGC
TCATAAAAAGCTGCTGTTTGGCAAGGGAGAGCAAACCCTTAATAGCGCGCCGACGCTTTTTGTTCGTAAAGGTAAATATcaaatggcgtatcgctcactc
CTATAGCAATTTGATGCGCAGACGATTTCTGTTTAGAGACCGATTCCGCGTGAAGATGTCATAATCCACCATATGCTCAACTTACACAATTTAGCGTACT
GAATTTAggtgatggatattaccaaatcTTGTCGCGCCCATTTGATGGCTATTAGTACACCGTCCGGTATGTtatgggagtggcttgtgacACCACAAAG
ACTGTATAATGCTCTAGATGCGTTTAATCGATAGGAATCCCGTATGTTTTGACTACTATGATGCTTCGCACAAACACATTATAACGATACTTTTGTTCAT
TCGTCAGATGACAGGTCTGTCTAAGAAAAGCACTTGGTGCAACTTCGTGTGGTGCTGGCATGTATGCGCGAACTTTCATTGCGAAAGAGATTTGAATTTG
TATGTATAGTGCTGACAAGGTACCGGAGCTCGGTTGATAGATTTATGAACACTTTGTTCGTGCAGACCTTGAGAATACCAAAGAAATAATGGATTGACCG
ATGCCTCAGAAATGGAATGGTTTGAGAAACGATTTTTTTGTCGAATCACCTGCAACGCTTATCGCGGAATTGATACGCCCACTATCAAAATTGCCGGAGA
ATGTCGGAGAAGAATCACTCACTCAGATCAAGAATGTTTTGGTGAAGGCACCATTTATTGCTCTATCGGAAAAAACGAAGCTGTGTAGCGTGGTTTGTGA
CGCCTCTAAGTTTGCAATCGGTTATGTACTATTGCAAAAGGGTCCAAAAGGACACGATCGTTGCGTGTTGTCTCAATTGCGACAGCTGGGGCAAGCAGAA
aatgaactacccagtcaaCGGCATGGACCCTGTGGCATTGAAATATGCTCCGGTAAACTTCCGTGTTCACGTCTCACCTTCAACGCTGTTAGTAATCTAC
ACGGATCACGCAAGCTTGCGATATACTGATCAGTCTGCTCACTTGTCACAGCACATTTCTGAGTTGTCACTCGTTACAACATACAAAACGACGTATTCGA
TTTGATACGTCGAGCGTATGTTGAAGAAGAGCTGTGTGATCTGAGCATCAAGGCGCTCTCACCGAATAAAGTGGAACTTCATGACAAGCCTCAGGTTCGC
TTGAAATTACGGAGGCATCGTTTTGCATCGAAAAATGGCCTTCTTCACTACATATTTGTATATGGCGACGAGCCGCGGATTGTGACTCCTCACAAGGATG
ATTCTAAGTACAGAATCGTGCATGAGACGAACGATACACCAACGGACGGTCACTTTGGCCGCGAAAAGATCTTTAATCTCTCAGAGCCCAGTTTTGCGGT
CATGCATGTACAATTGGGTTGCACGCTATGTGAGGATATGTTATGTCTTTCAGCGCGTGAAGAGCACCCGGCACACTAAACTAGAACTGTAGAGTCTCCA
TGCTCCTATTGACTACTGGAAGCTAAAGTGTTTTGATTAAaatttctgctttcccgaaAATGCCGATGGTTACAATATGGAGCGATCGTCTTCGTCGAAA
GACTCAGCAATATGGTTTGCATCGCTCGATGTAGCGATTCTATCGATGCCGCACATTCGGCCATACTATACATTGATCACGGtttttttgcaaacaaaGG
TTGCTAGACGGCATCATTCCTAATCGTGATTCATAATTCAAGGAAGGCTTTTGGAGATAATTGATTTAAATTCTTGGCACTCGCTTTGATATGTTCACAG
CAGTACACCCAGAGACCGATGGGCAAACAGAACGTGCCGACCGAGTGATCGTTGATGTGTGGAGAATCTTTTGCGCGGAAATTCCCGCCGGATGGAGTCT
CTTGTTACCGTTGGTAGAGTTTGCTATGAACAA