Description :
From Genome Similarity Track
Location :
Scaffold_1902:1505- 3572
Sequence
2067 bases(100 bases per row)
CCAGAGAACGCCAAACAGCTGCGACAATGGCTGGGTCTGGCCAACTACTTGCACAAGTACACGCGCAATTATGCAGCGTTAGTGCAACCGCTCACGAAGC
TCCTGAAGAAGGATATTGAGTGGGAATGGTCCAGTGACCTTTCGGCAGCATTTGCCGAAGTGAAAAGGAGTCTGCGAGAAGCTCCTGTGTTGGCTCTTCC
AAATCACGAGAAACCATTCCATGTGGTTTGTGATGCGAGCGACTATGCCATCGGTTGTGCTTTGATGCAACACGATGATGAGGGTCAAGAGCGAGTTGTA
TCGTATCAGTCACGACAACTCCGACCCGCAGAATGGAACTACCCAGTTCATGACAAAGAACTTCTAGCAATGAAGTATTCTTTAGTCAAGTTTCTTATCT
ATTTGCTCAGCGAGGAGCGCTTCGTGATCTATACTGATCATGCATCGCTGCGAACAGCGGTAAAGACTCCTCATTTGTCGCAAAGAATGGCGAGATGGTT
CTCCTTCTTTGCAGAGTACAACTTTGTTGTGCACTACAAGCCAGGTAAGACGAACATCTTAGCTGATGCGCTGTCAAGACGTCCGGACTACGATCCAATG
ATGAAGAACGAAGAAACGGACGGAGCTTGTCGACAGTGTGAAGATGTTCAAGCGATTGCAGTTCAAGCTACGACGACAGTGCGAGAAGAGATTCTCGAAG
GGTATAAGTCTGACGAGATATGTCAAGACCTCCTCAAGTATCTCAAGGACCCTTCTGTCAAGGCACTGCAGAGCTTGCCTGCTCGAACAAGATCGAGAGT
TCATCGCTTCCGAGTACACAATGGGTTGTTGTACTACGCGGTGGAAGTTGAGGATACAGCACGAGTTGTTGTTCCCAACGATGAAGGACTACGTCATCGA
CTCTTGTATGAGTACCATGATAGTCCTTCGGGTGACCATCTCGGACGTGAGAAAACGTTTCTCAGTCTTTCCCGGGATTACTGCTGGCCACACATGTACA
AGTGGGCTCGCAAGTATGTGAGGACTTGCGAGATCTGACAACGAGTGAAACCTTCTAGTTCCACGCAGGCCCTACTTCGTCCGCTGGCTTTCCCGTCGGA
CAATTGGAGGTCTGTGAGTATGGATTTCATATTCGGTCTTCCACGTGACACACATGGACGCAACGGCATCCTTGTGTTTGTGGACCGATTCAGCAAGATG
GTCATCTTGCGCCTGTTTCGAACAAGATCTCGGCTGAGAAGGCTGCACAGATCTTTGTTGACGTTGTACTCCATCTGCATGGCCTGCCAGTCGAGATCGT
GTCTGACCGTGACACCCATTTCACTTCGAAGTTCTGGCATGCACTATTCGGACTTCTGGACACCAAGTTGTCCATGTCAACAGCGGCACACCTTGAATGG
ACGATCAAACAGAACGAGCGAATCGATTCCTGGAGGACGTGTTGTGCAGCTACGCGACGTCTTTCAAAGAGTGGAGCGAGTTTCTCCCTCTTTGCGAGTT
TGCGCTGAACAACTACACGCATGTCTCGACAGGTCACTCTCCACTTTATGTGAAATATGGCATTCATTCTCGAGTGCCTGCTTCTATAATGGATGAGGTC
TCTACCTTAAGTGGAGGAGGGACTACGGCTCACGGAAACAAGCCGAAGTAGTCTTACGATCTGAACGCTTCTTCCGAGTTAAAAGCGAATTTTGACTCGA
TGAAACCCCTCCACGATCTAACAACTCGTGAAGAGCAGCACATCGATGACTTTATTGTGAGGAAACAAGCCGTTGTGGGTTTGTTCGAGACGCGATTGCA
AAGGCTCAGGATTTGCAAAAAAAAATAAGCAGACAAGAGTGAAAGGGAGAACAAGCAAGTGTACTCGAGCAATGATCTTGTATTGCTTAGTACGGTTAAC
AAGCTTGAACATGCAATGTCCAACTTGGGAAGCTTGAAGCTTCTGCCAAGGTTCATTGGACCGTTCAAGGTAGTGAAATGCAATGGTGATGCCTACACGC
TAGACATACCTACACGTATGCGTCTACATCCTGCATTTTATGTGGGTAGACTGAAAACGTACCTTTC