Description :
From Genome Similarity Track
Location :
Scaffold_15:150490- 152581
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_05178conserved unknown protein

Sequence
2091 bases(100 bases per row)
TCCTTCGTAACAGGGTCGACGAGCGGGCTAATGCCCTTCCAGATGACGTTGAACCAGGTCGGGACGTTGACGATGAAGATCTGCGCGCTGCGCTCGGGGT
AGTGCGCCGACACGAAGGCCATCGCCCGGCGCACAAACTCCATGACCTCGCCCGTGAGGTCGTAGAACCCAACGCCTTCGGCGTCGAGCACCGAGATGGT
CCGGCCCGTGTCGGACGGCTCGAGAACGAGCCAGAGGTACTCGGTGATGTACATGTAGTGGCGGAGGAGCTGGTCCAAGCTCAAGCCGGCGCTCTTGAGG
CGCTTGAGATCAATCTTGCCGAGCTTTTCATAGTAGACGCAGTTGCCCTACGCATGTCTAAGTATCAAGTTGATACAAAGGCGCCGTACGTTTTTGGAGC
GGCCGTGAAAGTACTGCGGGTAGCACTGCTTGATCAAGTGAAAGTGCGGCTGCACCTCGTAGAGGATGCCGTCGACGTGGTTCTCGCGACGCCACTGCAG
CGTCGCCTCGTAGCGCGCGCGGCCTTTGACTTCGTCGCCCTTCTCGGCCGCCACGAAGCGGGGCGAGAACGCCAGCTCTGGAATCACGTCCGGCCGCACG
GGCGCCGACACGACGACCTCGTCTGCCTCGTCCTCGGCTTCGGGGCGCTCGTCCTCGACCTCGGGGCGCTCTTCGTCCGGCGACAAGAGGTCCACCGACG
CGACGCGGAGGACGACGTTGTAGAGACTCGCGGTGGGGGATGGCGGCGATTCGCGGGCCGCCGAGGCTTGGAGCACCGACGACAGCTGCGCGTAATCGAG
GTACGCGACGCCGAGGACCGAGAGGGCGAGGAGCACCCCGAGGGTCGCCGTGACCTTCATGACGCCCTGGAATGGCGGCGAAAAGGCCAGCGCAATGCCG
CAGCTCACGAGGTAGAGCGCGCCAAACGTGGTCGACGTCGTCAAGAGACTCGGCACCGGCGGCCGCTCGGGCGCGAGGGTCGCCGACGGCACGCGTGACA
CGACGCGCGTCACGTGCGCAGCCACTACGCACACGACGTGGAGCCAAACAGCGAGACGAACGACATACCGGCGATGGACGTGCGGGCACCCTTGAGGACG
CACTCGAGGCTGCCGCGGCCCGACGCGTCGACGGCCGCGATGATCGGCGCCAGCTGCGCGTGCGGCAAGACGACGACGTCTTGGTTGTTCATGATAAAGT
AGCACGCTTCCTTGACCTTGAGGCCGAGCGGAATCGGCCCGAGGAGGATGTCCTTCTCGAGCTCGAGCTTGCGCGTGATGAGGCGCTCGCGCCCCGCCGC
CGTCGACATGGAGAGTCCAAGTACGATTGGCTGCATGTCCTAGTGGAGCATCAGGAGATGATGCATCGAAATGCAGTGGAACGTACCCGGGATGGGGACG
GTGGGAGGCTGCCGCTGGGGGCGGCCACCGCGGCCGGCGTCGGCTGGCGACCATCGGGAAGCTCCGGGGATGTGGGCACGCCGACTGCGATCTTGGTGTA
CATGTCGAGCATCTCGGCAGTCCATTCCGTCGGGAACGCTTTCTTCTTGCCAATCTCGAGCGCTGCGTTCACGGACGTGGCCCAGTACTTGGCCGAGTCG
GCCGACTCGACGCGCAGGAACCACGTGAGCGTGTGTTGCTTGGAGAAGATGCCCACAAAGTGCGAGTCGACGCCGGCCTCGATGGTTCCGTACGGCGCCT
CTTCCTCCGGCACGACCTTGGCGTACCCGACGTCCTTGAGCGGCAGCTGGCCGCGCTCCGTGCCAAACACCTCTTGTTCGTCGCCCTTGCGGTAGTAGTG
GAGCCCACGTACACTCAAAATGAAGAGGCGGCGCGCAAACCCGGCGCGAACTGCGCCTTCGCGCCGCTTGTCGACGAGGCCGGACGCGAGGATGCCGAGG
AAGCGGCCCTCGAGCATGCCTGGCAGCGCGCCCCGGAAGCTCGAGTTGCTCCGGAGGACCGAGGACGACGCCACGGACGAAGACGACGAGTTCTGGCGCT
GGAGGCGCGGGCTGCCGCTGGGCTCGCTCGCAGTTCGGCGCATGCTCTCGCTCATGGCACGTTGCAAACTGGATGACGGAGACAAAAAACG