Description :
From Genome Similarity Track
Location :
Scaffold_25:15047- 20768
Transcript NameFunction/comments
Phyra_77481expressed unknown protein

Sequence
5721 bases(100 bases per row)
TCTCGATGCAGTGTCTCGCTATTTCAGTGCGGACTGGACACCAAGCTGGTAGGAACATTTTACTGTGTCGGTGCGGCTCACGAATACTGATGGTCTGATA
AAATTGTCCTATAGCGAGGTCCTGATGTGGGAGGCGCGGATGGACATACCACAAGCAATAAATCCCAAGGCTGTTCGTCTTGATGTGTCAGACTGTTCGT
TCATTAGACTCGTTGTGCACGCGCCACACGAAAGCGCTTGTAATCGATCTCACGAGGTGCTGCTGCATTTTTGAACTGCTGTTGGCATTTAGTTTTCTAT
ACGTGGCTGACTTTTCTGCCTTCATGCAGGTCGTACTGGAAGATATAGAGCTGTTAGGGCTAACTGGAGGTACATCTTGTCGGGCTCGAAAGCTGGACCC
AAATTTGAGGATAGTCGACAGGCAGGATGGTCCGTTCGACCACTGTTTTGGTCGCATTCGCCGCCCCTTATTACTTTCTCCGGACAACGATAGTGACGAG
TTGCAAGCTGTTTTTTTGGATGCCGGCGTACCGATGAGTATCGTAGCCCAGGTTGCCACGATCCCAATCGTTGAAGCTGTAGTATCGGCTTCAGCGCATA
AAGGCATCAAGCCACTTGCTGGAGCTAGTGAAGTCGTTCCTAAATCAATCCCTCAAGATAACGAACTCACCGGCGTCCCAAAGAGTGACAGTGGCACCAT
TGCGCCGCTAATAGGTCGCGATAGCAGCGACCAAGACAGGGGGCCAACGTCACCTTTCGACCGAGCGCTCCGACAATATATCGAGCAAACAGCTCGTGAG
AAAGCTATACTCGAGAAAATCCTTGCCACTGAAATCTGCGTGACCACAGACGACGTGGCGAGTTGGCAATCTCCCACGATATCACCCACTGACCCCACTA
ACAGCAACGAGATCACGCTATACACGTTTGGAGAATTTTTTACACAATGTCTGCTCTGTGGTGGATCCGATATCCAAGTAATGTGTGTACAGATGGCTGA
GCGCTTTGCTCGACTTCTCAAAGACGTCGTTGGTGCAACATCTGCGCTCGAGGGTATCGTTGCACTTATCATTATAGGTGTTCGGGGGGCAAAGTCTTCT
CGTGTGTTCCGCGCAACGATTCATCTAGCACACACTGTGTTTCTGACTAAAATGGCAAATACGAAGAAGACAACATCACAATATCAACCTGGGGGTGGCA
ATACCCAGAATACAAATGACCCTGCAGCATCTGTCAGTACGTCGTCGCTAGGGCTAATAGAGGAAGTTGGTATCACCAACGTGAGCTATGGGTTGCGAAT
CATTCTCGAGTCAACACTTGCGAGCCAACTTTGTTGGTCCTCCATTAACCACGCTAGCAAGCCAACATTTCGTTCGAGTACCAACCCACACAGCCGGAAA
GTTTCGGATGGGCTTCCTAAATTGCCTCCGTCAATCGACAGGGAGTTTCTGTATTTTATCCGGTCGCTGATCGAGCAAGATCTAACACGTGCAAGCTTTT
TCGAAGAGCTTCTTGGTCTTACTCCTACCGACAGTGCTGCCGGGGTCATTTTCACGACAAGCCGATTGCGATTGCTTCGGTTGATCTTGCGGGATGACAT
GATTCACTGTCGAATTTCAACCAACGTGAAGGCCAGTATACACTCGCTTTGCTCCAACTGGTTGATGCCGAAAAGGTCTTCATCCCGTGCTCTGGAAAAT
GCAAACCTTGATGACAAAGATGCAGTAGTAATACGACTTGCTTCGGAATGCTTAAATGAAATAGACCGATCGTCTTCAATTTCTCAACAAGCCAAGGATA
ACGCCAACCTTGTCAAGGGTCTATTGGTCGCTGTGCCCAAACACCTGCAAGTCGCAAGTATTCTAAACAGACATCGCTCCAACTGCCACTATCACACTGC
TGACTTTGTTCAAGACCCGCTTACGGAATTGGAGATTGCTGAGTTTGCCAAACAAATGCAGCGATACTTTTCATCCCAGCCTCGTCCGAGCGCCCTGTAT
CGGCACGTATTTGTACGTGCACCTCAAATTATTATAGAGAAGGATGAAATGGAGCAATGCGAACTGTTTCAAAAAGGCAACATCACTTTCCAAGGGCAAG
TTGTTGCCCGAACACCACCGAAAGAAACTTTTCACGAGGAGATTCAACGAAATGCAGCTTCATTTGTGTTCGACGTTGGTACTCCAAGCAGCACGAAGGT
GGCTGGTACAGCACCGCCACACCACCAAGAAGTGGTCTCGAGTTTTGCAGCTTTTCGAGGAACAATCGAACAGCGTAGCGATCCCCCCAAACAGACGCGC
AAAGTTTCCCCCGAAGATCACTTACAACCTCCCAAGACCACCAAAACTCTAGCGGTGACAAGTAATCAACCTGGCAAGAATGCTGTCAGTACAGCAACCA
TGATTGTGTCAAGTGATGCAACTTCTGCTGCTGCTGCTAAAAGCTCAGTTCAGGTCGTAGAAGACTCAACCAATATTGCAGATAACACACTTTTACAGGA
AGTACCTGCTGTAGCTCCAACCACAAGCACCGATTCAGTTTTGCTTCCTGTCGCTGTTACACAAGACCCCACCAAGCAAAAAGCAATTCCCTATCAGCCT
GAACGGGCCAAAGTCAAAGGCAAGGAGAAACGCAAAGTCAAAAGCGGTGCTAAAGATCAAGACAACTGCGTACTTCAGTAACAGGCTATCAGCAGCAAGC
TAATAACCAGTGCTCTTTCGTGATCGATAGCTTTGTACGCTCTGATTCAAGGAAAGTTCATATCGCTCCTGGAGCTCCGTTGATAGCTTCTTGACGTAAT
GTTTCATTATGAATTCTTCGTCAACGTCACAGCAGAGGGCAAGTACTACCTGCTTAGCAGCTTCGCGGATAAGGGAGATTTCGTGTTGAGCAGCGCCGCT
AAGCAGCAAAAAGCGAAGGATACGTCGGGGCGCGATATCAAAACTTGCACAACAGTGAAACGACAATAGTAGCGCTGCTAAAAGCTTCAAGATCGCTAGA
AGCTGCTGGTCTGAGTGTTGGAAGTTTCTCCTCTCGGCATCTTTTAGAGTGAGGTGCGTCACGAATGTCCCTCTTGTTCGTGTTGTCCCAGCGACCTATA
CACGTGTTTCCAAACTAGCGTAAATTCACTGCGTGGAGGCGTAAAGATTTTACGGCGTACCTACCTTCAAAATAGTGAACGCAGCAACATTGCGAATTGG
CGCCTCGCGTGCGCCAAGCCTGTCTGTAAGTCGGGCAACAATTTCGGTAACCTATATCACATATCGAGCATTTCATGAGTTGTTGTTAGCTCCAGATACT
GTAGTCCGAAACTAAAGTACTACTGACTTACATCCAATTTTGAAGCGGCTGCATCTTGGAAGTATGGTAAACAAGTTAATAGTGCCCGTAAAAACCCGCA
GCCGGCGGCAAATACTTCGGCGTTTGTGTCATCCAGAACTACAGCCAATATCTCTAACGCTTCTGCACCCGTTATCGCAATTTGGCAACTTTGATCTGTT
ACCTGCGAGCACTCTGCAAGCTGCCATAGTAATGCTTCTCTCTCTTGCCACTGACTTATCTTGAGCCTCTTCAGTATGTCATGTGCTTTAAGCCCCTGAA
GTGCTGTCAGCGCATGTTCATCTTTATCGCGCGGTCTCGGCGAAGAGGACATTTTCTGGGATAGCATCTTCTCTAGGTGATATCTGCGTTGCTCAAACTC
AGCAAACATATCGAGATCATTTACATGTTTGGTATCTTCGAGCTCTTTTGTACTTTGCCCAAGTAGATTGATCAAGTGGCTAGCTTCCTGCTCCAAGGAA
ATCCACGGCTGTATTTGCTTCTCATTGCCAGCATATTGAACGAGTTGCTTGCCGATCTGAATGTCTGCGAAAATTTGCTCTGGTGTCTTCATTTTCTGGG
TGTCTTGAATCCAGATATCTGCTGCCCGAGGGGATCTCATTTCCCGTTCTTGCGCTGGGCTGGGGGTGGTCGTGTCGTAAAGACTATGGACACGACGACG
AGGTGACTTTTTTGATGCACTCTTGAGAGGAGGTGGTATCAGTGGCAGCGCCACCTTCGCAATTTTCTGCGGTTCGAAAGCTGCTACTGATGCCAATCCA
ACTTGGCTAAAGAGATTGGTTCTTGTCTGATGGCACGGATGCAAAACCAGACGCAACAGTGTAATCTTCGAAGGTTGGGGAAGCTGCACCTCCTGAAGTT
CGCAAGCAGCACGCTGCGCCTTTTCATTGCTGCGAAAGCACACAAACCCAAGCCTCTCGAATCTGACACCGGTCCTACCGTCGTGAATTCCATTGCTTGT
GGCTGCGGACGTGAAAATCTCAACTCGGGTCGCCACTTTGAACGGGTGCGATAGCAGATTCACCTGCTCAATGCATGTCGGTAAGCCTCGATTGACGCGA
AATACCAACTCTTGCGGGAACTCGCAGAATTTCTCCGATTCCCACACCGCCAACTGGGACGACGGCAAGGTCGATGCGCATTGGGATAGCGTCAGGTTGG
CTGCGGGAAAGCGCACATCCTCGCTGGAGCAGTACAGGAGTTCCAGCAGAGAAGAAGCCCGCTCGCCGTCACTCATTACTTCAATCAACCAAATGCCAAC
ATGAACTCGGCACAAATGACTGTATTTTGGCACGTATAAATAACTTCAACGGCAACAAAAGGACGCTCACTCGTTTTCCAGAATGATGGTTCTTTATGTG
TACATACACCAGTCTTTTTTGTTCCAGAAGGACCAAATCGGCACAATTGAAAGCGTCCGCGAATCTCAAGATTTAACCTCAAGTAGTGGAGAGTGATGCC
GACGTTGAGCGACGAGGAGCAGGAGTTGATCCAGAAGGACCGCGAGGCCAACCCTGGCTGCTTCTACTCGACGGCTCTGTCGCAAAGCTGTAGGTCCATC
AACGGCGACAGCAAGTGCGAGATCATCAAGAAAATCTTCCGCCAATGCCCCAACTCGCGCAAAGAGCTCATCTCGAACCGCAAGGAGATCACCGAGGACG
AGCACAGCGGAGAAGCGTCCACCGGCGACTTTTTCAATCGGGAGAGGATGGATCCACGTAAAGGGTACGCGCCGATTGGGACGGAGCTTTTAGAAACTGA
GTGCTGACCGTGGGTTTGATGTATTGTGTTAAGCAGAGGGGACAAGGACTTCTTTTTCCAGCAACGGTATGTTCATTTGGTCTTTTGGAAGGGGTTTTGG
TGTCTGAATCTTTGTTGCTATTTGCTATCAGAGGTGATGACTTTGAGGCCCAAATGAGTCCATTTGACTTCCTTCGACAAGAAATGCTTCGTCCATTTGA
AGGTACGAGCTGTCTGCTGTTAAGTGAAGGAGTTTAGTGGTGGTCTAATGATTTGCTGTGCTATTCGTGCTCCTGCTGCAGATTTCTTCGGTGGTGGCAT
GATGGGCCGTGGTGATTTCAATCCTTTTGAAGGTCTAGAGGGAGAGTTTGAGCGGATGCCGGTGCGTCCACCGTCGCCCACACCCAATCGCCCTTCACGA
CGACAGGCTCCTTCCAACCCTCCACACTACTCCTTCCAGCCCTCACAGGGAAAAGGCCCTCATGGTACGCTATTACATGTAGCTGTTTTAACATTTGTAG
TGGGTTACTGTCTCTAATGCTAATTTTGCGATCTTCCTGCAGAGGCCGGCGCAAAAGCGCGCGCACAAGGCAAGAGCGATATGTTCGCTGACTACTCGGG
TCGTGTGGATGAAATTTAATG