Description :
From Genome Similarity Track
Location :
Scaffold_957:15046- 16152
Sequence
1106 bases(100 bases per row)
TCTGCGCAGACAGTCGGGCAAAAGGTGACGGAGTCGATCTTCTGAGCGCAGTACACGAGCGATCAGCTGCTTCGACGGCTTCGTggcaagctcgtcgagc
gtgaCGCCCGCCAGGTTGGCGGCAGTCGGAAATGAGCAGCTCCTAGAGCTTGGTCAGGCGAGGGCGTGTGTGGAAAGATTTGGATGCAGATGAGACAATG
AAGCTTTTGTTGCTTGTTGATGAAATTGAATAATGAGCTGCGCAGACATACCTGATCGGATCGCCAACGCTCCAAGCCCCCACgttcctccttctcgtgA
CTCTTGGTTTATCCATGCGGCTCGGATACTGAGTTCTCATTGGTGGAATCTAAATGTCGAAGCTGATTGGTTGGTTGATGATACTAATGCAGTACATTAC
ACGCACAATGAGTTTAAATACGTGCATCACCTCCTGCAGGTTGTAATATACTACCCGTTCGCTATCGAGGGTCATTACTGTAGCAACTTATACCTTAGGC
GTGTTCGACTTGTTTGGCTCGGACCAACTCCTTTGCAAAATTCGCATTTGAAGGaggttgaagcagctggttCGCAAAAAACATAGTCTTCCCTAAATTT
CGGATCCAGTCATTTTAGCCTCATTTCAGCCTGAAAAGCTCTTTGGGCTTTTAGTGTTCGAGTTAGGTCGAAAGAGCTATTTGGACTCAAAACAGCCATT
TACCCTGCAAACCAGTAATTTCAACCCAAGTCGAACATGGCTTTCACAATACGGTAGAAACGCAATGCTGAGTAAGTGCATTCAAGTACGCGCTTGGTAG
CCGCCACAGTATCACTTGCACAAGACGGTCGACAAGCAGTAAACGTGCACCTCAAACACTTACACTATGCAGTGCACAATAATAGCCAATCAGTAGAGCA
GCAAACCAGGTTGCACAACACGCCTATCTAAACAACTACGACAGCAACCTGTCAGTGTGTGTGTCTGTAGCCCCCCGGCGAAAAAATGCCCACTGGCTAA
TTTAGCTGCCGAGtgaagcgaaggcggcccCCATTGGCGGAAAATAAATTCGTATTTGGTGTGAGCCACGTTAGAAATCACATTTTGCGCCATTTTGAAT
TCGGGC