Description :
From Genome Similarity Track
Location :
scaffold_37:15043- 19115
Transcript NameFunction/comments
Pl_111479hypothetical protein PHYSODRAFT_313163
Pl_111480hypothetical protein PHYSODRAFT_345492

Sequence
4072 bases(100 bases per row)
GTCATGGCACAGCGCGAGATCCTCCATGACCTCGTGGAGCGAAGCCGCGACCGAGTGGTGCAAGTACGAGCTGGCAGTAGTCTACTCCACGTGTTGCATC
AGCAGCAACTCCATGCCCCAACACACCTCAGCGCTTCAACCTCATTGCCGCTGCTACCTCCAGCTCCGACGCTAGCGATAGCATCGAAACGCCGGACGAA
GGCCGTCACTATAGAACCAGTTAATGTACATAACGTTCGACGACGTCGTGATGCGTTGCCTCGACTTGCCAAGGACATCGTGCAGTTGCCTGAAGGCTCC
ACGTCCTTCGAGCAATACCAGAACTTCGTGGCCAACAAAGTCTACGGAGAGGAGACTATGCATCTGCAAAACCGACGCGCTGCACTAGTACCGAAAGCAG
ACCTGTTGAAGAAATTAGCCACGGTCTGTGCTGCTGCGCTCAAGGAGATGGAGAATGACGAGGATGCTCCTGCGGTGCGAGAATCACTGCGAGAGAAACT
TGTGCGTGCGATGGCATTGCTTCGGGGCGGGTGTGCATTTGCCAATGCCAAATCTCTGGCTCCACCTCCACCGCCAGTCTATGGGGAGATCAAGAATGCT
CACTTGGCCTTTCTTCAATTCAAGAGCGACGGAGTTGGCACTACGAAGCAGAAGCGAGTTCATCCGTAGGTTTCTACACTTCAACTACAGCTTCTGGACT
CGAGGATCTAACGTCTTACCTTTGCTGCTACAGGAGTGCTGGTCTACACGACGGCAACACATCGACAAAGATGCCGATCCACTTCGGTGACCAGATTTGC
TTACTCTCATTCAGCTCCGACTTGCCCCTTGCTATCGGACCCGATGGCCGCAGTCGTCCCGCACAAGACAGTTCCGTTGGACCTCACATGACCTTTACCA
TTGTGCGTTGGTAGTCGTATGTACTTAATTGCTCAGAGTAGTTGGAGGCTGACTTTGCCCACACATCGCTGCTCAGGTTGACTTCAGAAACCCGTCGCGA
TACGATGAGGTCACTGCTACAGACGACTTCTGGCTCCGCGTCGACCCAGCAATCCTAGCACCGCGGACGTTTAACCTTCGCCACACACGTTCCAATGGTG
GTGAGTTAGACTCGACAGGTGAAGATGGTGACGATGGTGATTTAACGTCACTCCTTAGCGACACAAATTACTATCTAGGATGTCCTGGTTGGCTCGATGA
TGGAGAATCTACTATGATTTCGACAACGACCCAAATCGGGAGTACACAAGGTCGGCCAAACGTATACGCAGAAGAACCTCGACGGTGTGGACAAAAACGA
TTTTGCATTGTGGCTATGAAAGCGTTGACTCCTTCAAAGGAGTACTACGGGGATGACGCAGCTACGCGTGAATATGCCATGGAAACTAACGAAGGAATAA
TGCGCTTGGCACGCTGGCGATTTGTGAGATACTCCCCGCTGGAGCAACAATTTGGAACTATCAGTGGTAGTGGTGCCGTTATTGATAAAGAGCAAGATGT
CAATGACGCTATGGTGAATTGCTCAATTGTATATCTTGTTCTAAGCGATTTTGCTCTCATGTACGATGAGACTTTCAAGCGTGGTGTTGGAGTGCACGTG
TCCGATGCCCATGCACCATCTTCAGAAGTGTTAAAGCTCCGTGAAAATGATAACAAAAAGAAACACAGGTATCGCCGTCATGATGGAGGAGTGATCGCAA
ATTTTGTGCGCTTTTCAGCGTGTGCACGGTGGCAAGTACGTATTTTACAGCGTACTGGTGGAGTCAACTACTTGCAAGAGCTGGAATCAGCTATGGAGGC
TCTGGTAGGAGACTATCGAAAAGAGGACGGTGCGCGTGTGGAGTGGCTGAGGGATAAAAAAGAGAAAATGGCATCGAACGATCGCCGATTGCAAGCAAAA
ACTAGGTTAGTGCCGGATGCTCGACGCCAGTACGACCTCATTGTCGCTCAAAGCAACAGCAAACTGGAGCAGATTGAACGACAAAAGGGTGATAATTCAA
CTGGGTACTTTCAGAAGCGACTTCAAGATTTGGGGACAATGGAACACGACTATCAACCATATGAGATCATGCATTTGAAGCAACAACAACTTCATCGGGT
TGTTGAACTCCCGCACCTATGACTGCCATGTGCACTTGAGCAATGATGCTGAAGCAACTTCATGACTGGTGCAATTGGTCCCAAACGCATCAACAGGCGG
ATGTGAGTCCGACTGGCTGCTTCCTCAAGTCGATGAAAATACCTGGTTGCGGCTGCGTAGGAAATTATCTCGATTGAGCTCCAACGGAGCATTGTGCGAA
TATTGTATGTAGAGGATCTTGTAAAAATCCGCACAACAGGAGCAACACGTCAATACCATCCATCCTCACTGAATCTTGATAATGTTCAAGAAACAACGTC
AGCAGATACACACCATGCTCGACATTTATCCACTGTACAATATTCTTCTTACTCTTTCTCGTCTTCTTTGCTTGAATTGTCTGATTTCGTGCTGCCATTT
TTCTTGCGCTTCTCGCGCTTCCGACGCTTACGGTTCTCTTTTTGAGCAGCAGACAGCATTTTACGTTTTTTACCAGTATGGGCAGTCTCATTTTCTGAGG
TGTTTGTTGAAATCGGGATATCTGCGCTTGGTACTGTAGTCTTTTTCTCTGTATCCTCAATCTCAGGATCGACACCAACTCGGTCAGTCCGTTCAAAATA
CGCCACGAAGAATCCGTTCGTCGAGTCCTCGAGGCCGTTCGCACGAACAAGTGCCTTGGCTTGTTCAGCGGATAAACCTGCGACCTCAAGCCCACGACGT
GGCCACGAAGTAAGAGCAGGTTTCAGCACAAACGGCCGTGCAGCTTGAATGTTTTCTTCAGATTTCAGAGCTGCAGCCACAACCTCCTCGTCCTCCTTCT
GGAAAATGGAGCAAGTCGAGTACACGACACGCTCTACCTGTGGAAAGGAAAATGCCTTACGCAGTGCCTCCAGCTGGAAATCAGCAAGAGACTGCAGACG
TTTGGCTGTGTCTTCCTCATATTCCGCACCATGGTCAGGCTCCAACACCGTATCTCGCGAACTCGCAATGTCTAGCAAGTGATCCAATCGATTCGTCATA
CCCGAACCAGAGCAAGATGGGTCCAGCAAAATGCTACGCACGTTGCGATACATTTTGCCATCCACCGGCACCTCCAAGAAGCTCTGTAGCTCAGCTTGCA
CGCGAGTTGCAGCACCTGCTAACTGCATGCGTCGTTTCAGCAGCTCGAGTCGCTTGGGCGATCGGTCGAAAGCAAACACTCGTCGCTTTGGGGTCACGCC
ATCCTCTTCGTTGCTATCCTGTTGCTGCAGCAACATCGCGAGATGACTGGTCTTGTTACCCGGCGCAGCACAGGCATCAATGACATCACCCTGCTTGTCT
TTGGCGTCAGTATGCTCTCCATGTAGCACAAAGGCCGGGAAGCAACTAGCCTTGTCCTGTAGCACGAGCTTTCCACTCTTAACCATCTCGTGCTCGTGCA
ACTCTGTTCCCGACGGCAACACGAGCAGATCCCGCACGTCTCGATCCTGTTTGGCGTCGTACTCACGCGTGAAGCTCTCAGCCTCTTCAGACGAGGTTAG
TAGTGTATTAACACGTACGTAGCGAGGTAGAGCGAGATGCTGCTGGCGGTTCTCGGGTGGTAAAAGCGCCTCATTAGACGCCACCTTGCGCTTGATCTTG
AGTCTCGCTAGCGCCGCGCGGAAGCCTGTTTGATGCTGCACGAGCGCCTTCTTCACGTATCCGCCGCCCTGGATCTTCTGTCTTCCGAAAAGCAGGTCAT
AGAGCGCCACAAACACGAGCGCGGGAGGCTCCTTGGCGTTCTTGGGCGTCTTGAGAGCCTTGTGGCACTCGGGCATGGCCGCCAGTAGCTCTCGCAGCAG
AGGTTTGTAGCGCAGTGTCTCACAGACGAGCGCGAACGAGCTGCGCTTGTGCACTGTAGACTCTGCATACGCGAGGCTCTTGAGGCCGCCTTGGCGCAGC
TCCAGCTTGTGTAGCAACGCTGCTGCCTCCTTGTACAGCTCGCTCATGGCCGTCAAGCACAAAATGACTGGA